Prev. |  KEGG KO K03267 > 

RIKEN DNA Bank Human Resource - GSPT1

Gene ID NCBI Gene 2935 |  KEGG hsa:2935
Gene Symbol GSPT1
Protein Name G1 to S phase transition 1
Synonyms 551G9.2|ETF3A|GST1|eRF3a
Ortholog resources KEGG ortholog (KEGG orthology K03267) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13270 pGEX6P-eRF3 Expression vector of human eRF3

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080979 IRAL002H11 pOTB7 BC009503 NM_002094 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE003059 W01A007K19 pENTR-TOPO IRAL002H11 BC009503 NM_002094  
HGE003063 W01A007K23 pENTR-TOPO IRAL002H11 BC009503 NM_002094  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042903 ARe07E07 pKA1U5 NM_002094.3  
GGCCGCCTCTGTCGTCGTCGCGAGTGTGGAGNCCTTTAAAGGAGCTGCTGCCGCGGCGAC
HKR442197 RBdS105I05 pGCAP10 NM_002094.3  
GGAGGAGGAGGGTTGAGCTGCTGCCGCCGCCGCCTCTGTCGTCGTCGCGAGTGTGGAGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl