Prev. |  KEGG KO K05768 > 

RIKEN DNA Bank Human Resource - GSN

Gene ID NCBI Gene 2934 |  KEGG hsa:2934
Gene Symbol GSN
Protein Name gelsolin
Synonyms ADF|AGEL
Ortholog resource in our bank

  GSN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096945 IRAL042G01 pOTB7 BC026033 NM_198252 Full
HGY089577 IRAL023P17 pOTB7 BC017491 NM_198252 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050923 ARe27F03 pKA1U5 NM_000177.4  
GGTGTGTCAGGAGAGGCCCACATAGCTCCCCCCAGCCTCGCGATGGCCGAGGAAGAAGCC
HKR176457 ARi41C09 pGCAP10 NM_000177.4  
AGCTGAGCGCAGCTGGACCCAGCAGCCGCTGTCTCCAGTGCCGCAGCAGCAGGTAGTGCT
HKR234963 ARiS087G19 pGCAP10 NM_000177.4  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl