Prev. | 

RIKEN DNA Bank Human Resource - GRSF1

Gene ID NCBI Gene 2926 |  KEGG hsa:2926
Gene Symbol GRSF1
Protein Name G-rich RNA sequence binding factor 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019254 IRAK048C06 pBluescriptR BC040485 NM_002092 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR060481 ARe51D09 pKA1U5 NM_002092.3  
ATCCTGGGTCCATGGCCGGCACGCGCTGGGTACTCGGGGCGCTGCTCCGGGGCTGCGGCT
HKR264476 ARiS161D04 pGCAP10 NM_002092.3  
GGTTCCACCATCGCTGCTGGAGCAGCTGCCTTCAGGCCCTGCGCCGCCTCCGGAGTCCAT
HKR375353 RBd38G09 pGCAP10 NM_002092.3  
GGTCCATGGCCGGCACGCGCTGGGTACTCGGGGCGCTGCTCCGGGGCTGCGGCTGTAACT
HKR376549 RBd41G05 pGCAP10 NM_002092.3  
GGCGCCCCCTCCGGAGTCCATGGAAGGGCACGCNCTGGGTACTCGGGGCGCTGCTCCGGG
HKR420547 RBdS051G03 pGCAP10 NM_002092.3  
TGTCCGGAGTCCATGGCCGGCACGCGCTGGGTACTCGGGGCGCTGCTCCGGGGCTGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl