Prev. |  KEGG KO K05771 > 

RIKEN DNA Bank Human Resource - NR3C1

Gene ID NCBI Gene 2908 |  KEGG hsa:2908
Gene Symbol NR3C1
Protein Name nuclear receptor subfamily 3 group C member 1
Synonyms GCCR|GCR|GCRST|GR|GRL
Ortholog resource in our bank

  NR3C1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07689 pGL4-phNR3C1 Promoter collection, Human NR3C1 promoter
RDB10440 pPyCAG-cGR-IP deltaN deltaS SVOri Expression vector of glucocorticoid receptor ligand binding domain
RDB15749 pmCherry2-hGRalpha1 Expression vector of human GR alpha1
RDB15750 pEGFP-hGRalpha Expression vector of human GR alpha1.
RDB15751 pmCherry2-hGRalpha/C421G Expression vector of human GR alpha1, DNA-binding-deficient mutant.
RDB15752 pEGFP-hGRalpha/C421G Expression vector of human GR alpha1, DNA-binding-deficient mutant.
RDB15753 pmCherry2-hGRalpha/A458T Expression vector of human GR alpha1, homodimerization-deficient mutant.
RDB15754 pEGFP-hGRalpha/A458T Expression vector of human GR alpha1, DNA-binding-deficient mutant.
RDB15755 pmCherry2-hGRalpha/C421G-A458T Expression vector of human GR alpha1, DNA-binding-deficient mutant and homodimerization-deficient mutant.
RDB15756 pEGFP-hGRalpha/C421G-A458T Expression vector of human GR alpha1, DNA-binding-deficient mutant and homodimerization-deficient mutant.
RDB15757 pmCherry2-hGRalpha/deltaNLS Expression vector of human GR alpha1, NLS mutant.
RDB15758 pEGFP-hGRalpha/deltaNLS Expression vector of human GR alpha1, NLS mutant.
RDB15759 pmCherry2-hGRalpha/A458T-deltaNLS Expression vector of human GR alpha1, homodimerization-deficient mutant and NLS mutant.
RDB15760 pEGFP-hGRalpha/A458T-deltaNLS Expression vector of human GR alpha1, homodimerization-deficient mutant and NLS mutant.
RDB18679 GR-pCR3.1 Expression vector of human glucocorticoid receptor (GR), CMV promoter.
RDB18680 pEGFP-GR Expression vector of human glucocorticoid receptor (GR), CMV promoter.
RDB18681 pECFP-GR Expression vector of human glucocorticoid receptor (GR), CMV promoter.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093489 IRAL033M01 pOTB7 BC015610 NM_001024094 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE043841 W01A109K01 pENTR-TOPO IRAL033M01 BC015610 NM_001024094 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050554 ARe26G10 pKA1U5 NM_000176.2  
GGCCGCCTCCACCCGCTCCCCGCTCGGTCCCGCTCTTTTNGCCCAGGCCGGGCTGCCCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl