Prev. |  KEGG KO K06890 > 

RIKEN DNA Bank Human Resource - GRINA

Gene ID NCBI Gene 2907 |  KEGG hsa:2907
Gene Symbol GRINA
Protein Name glutamate ionotropic receptor NMDA type subunit associated protein 1
Synonyms HNRGW|LFG1|NMDARA1|TMBIM3
Ortholog resources KEGG ortholog (KEGG orthology K06890) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056744 IRAK141O08 pCMV-SPORT6.1 BC065834 NM_001009184 Full
HGY096739 IRAL041O03 pDNR-LIB BC041788 NM_001009184 Full/var
HGY103772 IRAL059H04 pOTB7 BC084553 NM_001009184 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE010186 W01A025H18 pENTR-TOPO IRAL041O03 BC041788 NM_001009184  
HGE010188 W01A025H20 pENTR-TOPO IRAL041O03 BC041788 NM_001009184  
HGE010190 W01A025H22 pENTR-TOPO IRAL041O03 BC041788 NM_001009184  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047231 ARe18B07 pKA1U5 NM_001009184.1  
GGAGCGGCCGCCGAGCGGGTGCGGGTGCGGGCNCATCGGCCATCACCGCGCGGCCGCGCA
HKR169252 ARi23C04 pGCAP10 NM_001009184.1  
GGNNNGCTGAGCGGCCGCCGAGCGGGTGCGGGTGCGGNCNTTNAAGCCATCACCGCGCGG
HKR187235 ARi68B11 pGCAP10 NM_001009184.1  
GGGCCGCCGAGCGGGTGCGGGTGCGGGCGCATCGGCCATCACCGCGCGGCCGCGCAGCGG
HKR187746 ARi69G02 pGCAP10 NM_001009184.1  
GGCGGGCGCATCGGCCATCACCGCGCGGCCGCGCAGCGGACACCGTGCGTACCGGCCTGC
HKR222309 ARiS055M21 pGCAP10 NM_001009184.1  
HKR243726 ARiS109F06 pGCAP10 NM_001009184.1  
GGCAGGCCCAGCTGAGCGGCCGCCGAGCGGGTGCGGGTGCGGGCGCATCGGCCATCACCG
HKR277623 ARiS194A23 pGCAP10 NM_001009184.1  
CGGCCGGNCNATGGCNNNCNCATCGGCCATCACCGCGCGGCCGCGCAGCGGACACCGTGC
HKR277846 ARiS194K06 pGCAP10 NM_001009184.1  
GGAGCGGCCGCCGAGCGGGTGCGGGTGCGGGCGCATCGGCCATCACCGCGCGGCCGCGCA
HKR328174 RBb20H06 pKA1U5 NM_001009184.1  
GGAGCCGCAGGCGCAGGCCCAGCTGAGCGGCCGCCGAGCGGGTGCGGGTGCGGGCGCATC
HKR334426 RBb36B02 pGCAP1 NM_001009184.1  
GGAGCGGCCGCCGAGCGGGTGCGGGTGCGGGCGCATCGGCCATCACCGCGCGGCCGCGCA
HKR338569 RBb46H01 pGCAP1 NM_001009184.1  
ACCCCCAAGGGGGCTACCCCCAGGGGCCATATCCCCAGAGCCCCTTCCCCCCCAACCCCT
HKR345284 RBb63D12 pGCAP1 NM_001009184.1  
GGGCTTCCGAGCCGCAGGCGCAGGCCCAGCTGAGCGGCCGCCGAGCGGGTGCGGGTGCGG
HKR345355 RBb63G11 pGCAP1 NM_001009184.1  
TGCCCCCGTCACAAGGCCCCGCTGCGTCTTCCGAGCCGCAGGCGCAGGCCCAGCTGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl