Prev. |  KEGG KO K04364 > 

RIKEN DNA Bank Human Resource - GRB2

Gene ID NCBI Gene 2885 |  KEGG hsa:2885
Gene Symbol GRB2
Protein Name growth factor receptor bound protein 2
Synonyms ASH|EGFRBP-GRB2|Grb3-3|MST084|MSTP084|NCKAP2
Ortholog resources KEGG ortholog (KEGG orthology K04364) in the DNA Bank
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Jak-STAT signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX035689 IRAK089D17 pCMV-SPORT6 BC043007 NM_203506 Partial/var
HGY082045 IRAL005B21 pOTB7 BC000631 NM_002086 Full
HGY089439 IRAL023J23 pOTB7 BC009417 NM_203506 Partial/var
HGY095736 IRAL039F16 pOTB7 BC019082 NM_203506 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024447 W01A061B23 pENTR-TOPO IRAL005B21 BC000631 NM_002086  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR336076 RBb40D04 pGCAP1 NM_002086.4  
GGCATTGTGTGTCCCAGAGTGCCGGAGCGAGTCCCAGAAGAGAGGCGAGGCTAAGCCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl