Prev. |  KEGG KO K05361 > 

RIKEN DNA Bank Human Resource - GPX4

Gene ID NCBI Gene 2879 |  KEGG hsa:2879
Gene Symbol GPX4
Protein Name glutathione peroxidase 4
Synonyms GPx-4|GSHPx-4|MCSP|PHGPx|SMDS|snGPx|snPHGPx
Ortholog resources KEGG ortholog (KEGG orthology K05361) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018604 IRAK046I12 pBluescriptR BC022071 NM_002085 Full/var
HGX027648 IRAK069B24 pCMV-SPORT6 BC032695 NM_002085 Full/var
HGX033854 IRAK084K14 pCMV-SPORT6 BC039849 NM_002085 Full/var
HGX042996 IRAK107I04 pCMV-SPORT6 BC046163 NM_002085 Full/var
HGY091359 IRAL028G15 pOTB7 BC011836 NM_002085 Full/var
HGY096116 IRAL040E20 pOTB7 BC021567 NM_002085 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE094815 M01C037A15 pDONR221 MGC08-A08 BC039849 ENST00000354171  
HGE094863 M01C037C15 pDONR221 MGC08-A08 BC039849 ENST00000354171  
HGE094911 M01C037E15 pDONR221 MGC08-A08 BC039849 ENST00000354171  
HGE094959 M01C037G15 pDONR221 MGC08-A08 BC039849 ENST00000354171  
HGE095007 M01C037I15 pDONR221 MGC08-A08 BC039849 ENST00000354171  
HGE095055 M01C037K15 pDONR221 MGC08-A08 BC039849 ENST00000354171  
HGE095103 M01C037M15 pDONR221 MGC08-A08 BC039849 ENST00000354171  
HGE095151 M01C037O15 pDONR221 MGC08-A08 BC039849 ENST00000354171  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042121 ARe05F01 pKA1U5 NM_002085.3  
GGCCCCGCCCCCGCACCTTGGCCTAGCGCGGTGGCGTCACAGTCGCGCAGTCCTGACTAC
HKR042155 ARe05G11 pKA1U5 NM_002085.3  
GGCCGCCTACTGAAGCCAGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGG
HKR054506 ARe36E10 pKA1U5 NM_002085.3  
GGCCGCCTACTGAAGCCAGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGG
HKR058834 ARe47B10 pKA1U5 NM_002085.3  
TGCTTTTTTGCCGCCTACTGAAGCCAGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCC
HKR067651 ARe69C03 pKA1U5 NM_002085.3  
GCGCCTTTGCCGCCTACTGAAGCCAGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCT
HKR081277 ARf03D05 pKA1U5 NM_002085.3  
GGCCGCCTACTGAAGCCAGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGG
HKR082459 ARf06C11 pKA1U5 NM_002085.3  
GGAAGCCAGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGGACCATGTGCG
HKR172499 ARi31E03 pGCAP10 NM_002085.3  
GGCCGCCTACTGAAGCCAGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGG
HKR175612 ARi39A12 pGCAP10 NM_002085.3  
GNCCTTCTTGCTCTATCACCCGCTGATCTGTGGNTGGCNGGACAAGCCCCTTCTGAACGG
HKR209276 ARiS023D04 pGCAP10 NM_002085.3  
GGCCTTTGCCGCCTACTGAAGCCAGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTG
HKR218246 ARiS045K06 pGCAP10 NM_002085.3  
GGAAGCCAGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGGACCATGTGCG
HKR234183 ARiS085H15 pGCAP10 NM_002085.3  
GGCCGCCTACTGAAGCCAGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGG
HKR243857 ARiS109K17 pGCAP10 NM_002085.3  
GGAAGCCNGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGGACCATGTGCG
HKR264629 ARiS161J13 pGCAP10 NM_002085.3  
GGCCTACTGAAGCCAGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGGACC
HKR337627 RBb44B03 pGCAP1 NM_002085.3  
GGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGGACCATGTGCG
HKR343700 RBb59E04 pGCAP1 NM_002085.3  
GGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGG
HKR363652 RBd09C04 pGCAP10 NM_002085.3  
GGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGG
HKR364173 RBd10H05 pGCAP10 NM_002085.3  
GGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGG
HKR368528 RBd21F08 pGCAP10 NM_002085.3  
GGCAGTCCTGACTACGGCCTCCGGGCCCTTTGTCCCCGCTAGCGGCGCTCGGGGTGGGGG
HKR371372 RBd28H04 pGCAP10 NM_002085.3  
GGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGG
HKR372484 RBd31D12 pGCAP10 NM_002085.3  
GGCCTTTGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTG
HKR373650 RBd34C02 pGCAP10 NM_002085.3  
GGCCTTTGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTG
HKR379725 RBd49F05 pGCAP10 NM_002085.3  
GGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGG
HKR386855 RBd67C07 pGCAP10 NM_002085.3  
GTTTTGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGC
HKR386924 RBd67F04 pGCAP10 NM_002085.3  
GCCCNTTTGTTGCCGGCTCTGACTCGGGGCGGCCGCGGCGCGCGGAGCTCCGGGGAGTCA
HKR388475 RBd71D03 pGCAP10 NM_002085.3  
GATTGGTCGGCTGGACGAGGGGAGGAGCCGCTGGCTCCCAGCCCCGCCGCGATGAGCCTC
HKR390411 RBd76A11 pGCAP10 NM_002085.3  
GGCCTCGGCCGCCTTTGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCG
HKR391298 RBd78E02 pGCAP10 NM_002085.3  
GGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGGACCATGTGCGCGTCCCGGGACGACTGG
HKR398080 RBd95D08 pGCAP10 NM_002085.3  
GGCCTTTGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTG
HKR405350 RBdS013G06 pGCAP10 NM_002085.3  
GACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGGACCATGT
HKR406176 RBdS015H08 pGCAP10 NM_002085.3  
GACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCCGCGCCTGGCCTGGCCGGGACCATGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl