Prev. |  KEGG KO K00432 > 

RIKEN DNA Bank Human Resource - GPX3

Gene ID NCBI Gene 2878 |  KEGG hsa:2878
Gene Symbol GPX3
Protein Name glutathione peroxidase 3
Synonyms GPx-P|GSHPx-3|GSHPx-P
Ortholog resource in our bank

  GPX3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01610 pHEG21 Human plasma glutathione peroxidase-encoding genomic DNA

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008746 IRAK021O10 pCMV-SPORT6 BC013601 NM_002084 Full/var
HGX031866 IRAK079L02 pCMV-SPORT6 BC035841 NM_002084 Full/var
HGX039266 IRAK098C18 pCMV-SPORT6 BC050378 NM_002084 Full/var
HGY097158 IRAL042O22 pOTB7 BC025956 NM_002084 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056010 ARe40A10 pKA1U5 NM_002084.3  
AGACCTGGTGCTTCAGGCGGGCAGAATGACTAAGGGAGGAAGATGGACTGCCATGGTGGC
HKR172409 ARi31A09 pGCAP10 NM_002084.3  
GAGACGGACGGTGGCCAGGGATCAGGCAGCGGCTCAGGCGACCCTGAGTGTGCCCCCACC
HKR243692 ARiS109D20 pGCAP10 NM_002084.3  
GGAGCGCCGGACACCTCAGACGGACGGTGGCCAGGGATCAGGCAGCGGCTCAGGCGACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl