Prev. |  KEGG KO K00432 > 

RIKEN DNA Bank Human Resource - GPX1

Gene ID NCBI Gene 2876 |  KEGG hsa:2876
Gene Symbol GPX1
Protein Name glutathione peroxidase 1
Synonyms GPXD|GSHPX1
Ortholog resources KEGG ortholog (KEGG orthology K00432) in the DNA Bank
Featured content Huntington disease - human
Featured content Amyotrophic lateral sclerosis (ALS) - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082883 IRAL007D11 pOTB7 BC000742 NM_000581 Full/var
HGY088312 IRAL020M24 pOTB7 BC007865 NM_000581 Full/var
HGY103012 IRAL057I20 pDNR-LIB BC070258 NM_000581 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049651 ARe24C03 pKA1U5 NM_000581.2  
TTGGGCTTCTTGGACAATTGCGCCATGTGTGCTGCTCGGCTAGCGGCGGCGGCGGCGGCC
HKR052901 ARe32E05 pKA1U5 NM_000581.2  
GGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTGCTCGGCTAGCGGCGGCGGCG
HKR060951 ARe52G07 pKA1U5 NM_000581.2  
GATANATGCTTGNTTCGGGGCGCTCCGAGTGGCTTCTTGTACAATTGCGCCATGCTGATG
HKR074580 ARe86H12 pKA1U5 NM_000581.2  
GACAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTGCT
HKR168578 ARi21H10 pGCAP10 NM_000581.2  
GGCTTCTTGGACAATTGCGCCATGTGTGCTGCTCGGCTAGCGGCGGCGGCGGCGGCCCAG
HKR171307 ARi28E11 pGCAP10 NM_000581.2  
GCTTCTTGGACAATTGCGCCATGTGTGCTGCTCGGCTAGCGGCGGCGGCGGCGGCCCAGT
HKR172101 ARi30E05 pGCAP10 NM_000581.2  
GCTTCTTGGACAATTGCGCCATGTGTGCTGCTCGGCTAGCGGCGGCGGCGGCGGCCCAGT
HKR172121 ARi30F01 pGCAP10 NM_000581.2  
GGACAATTGCGCCATGTGTGCTGCTCGGCTAGCGGCGGCGGCGGCGGCCCAGTCGGTGTA
HKR181305 ARi53E09 pGCAP10 NM_000581.2  
GACAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTGCT
HKR209251 ARiS023C03 pGCAP10 NM_000581.2  
GATAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTGCT
HKR238591 ARiS096H23 pGCAP10 NM_000581.2  
GATAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTGCT
HKR264568 ARiS161G24 pGCAP10 NM_000581.2  
GACAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTGCT
HKR264664 ARiS161K24 pGCAP10 NM_000581.2  
GACAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTGCT
HKR264776 ARiS161P16 pGCAP10 NM_000581.2  
GGGCTTCTTGGACAATTGCGCCATGTGTGCTGCTCGGCTAGCGGCGGCGGCGGCGGCCCA
HKR324521 RBb11F01 pKA1U5 NM_000581.2  
GACAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGNACAATTGCGCCATGTGTGCTGCT
HKR325203 RBb13A03 pKA1U5 NM_000581.2  
GACAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTGCT
HKR342523 RBb56F03 pGCAP1 NM_000581.2  
GACAATTGCGCCATGTGTGCTGCTCGGCTAGCGGCGGCGGCGGCGGCGGCCCAGATCGGT
HKR343649 RBb59C01 pGCAP1 NM_000581.2  
TAGAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTGCT
HKR391202 RBd78A02 pGCAP10 NM_000581.2  
GACAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTGCT
HKR394498 RBd86E02 pGCAP10 NM_000581.2  
GACAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTGCT
HKR402930 RBdS007F10 pGCAP10 NM_000581.2  
TCGACAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl