Prev. |  KEGG KO K15307 > 

RIKEN DNA Bank Human Resource - GPS2

Gene ID NCBI Gene 2874 |  KEGG hsa:2874
Gene Symbol GPS2
Protein Name G protein pathway suppressor 2
Synonyms AMF-1
Ortholog resources KEGG ortholog (KEGG orthology K15307) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY092356 IRAL030O20 pOTB7 BC014192 NM_004489 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR054173 ARe35H05 pKA1U5 NM_004489.4  
GGAGCCGCTGAGAAAGCGCAGAGAAGGCGGGCCCCGTTCTGAGGTCTGGCAGTCAGAGAC
HKR076149 ARe90G05 pKA1U5 NM_004489.4  
GGNTCGGAGCCGCTAANAAAGCNCAGAGAAGGCNGCCTANTTAAGGGCAGTCGTTCCGCG
HKR336147 RBb40G03 pGCAP1 NM_004489.4  
GGCCCGCCTCCCCGCAGGCCCCGTCTGAGGTCTGGCAGTCAGAGACAGCCGGGCGCCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl