Prev. |  KEGG KO K12175 > 

RIKEN DNA Bank Human Resource - GPS1

Gene ID NCBI Gene 2873 |  KEGG hsa:2873
Gene Symbol GPS1
Protein Name G protein pathway suppressor 1
Synonyms COPS1|CSN1|SGN1
Ortholog resources KEGG ortholog (KEGG orthology K12175) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001505 IRAK003M17 pCMV-SPORT6 BC000155 NM_004127 Full
HGY100313 IRAL050N01 pOTB7 BC064503 NM_212492 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR183776 ARi59H08 pGCAP10 NM_004127.4  
GGGCGGGGTGGGTGCAAGATGCCGCTGCCGGTTCAGGTGTTTAACTTGCAGGGGGCCGTG
HKR203202 ARiS008A02 pGCAP10 NM_004127.4  
GGGACGGCACGCCGCGGCGGGGTGGGTGCAAGATGCCGCTGCCGGTTCAGGTGTTTAACT
HKR264644 ARiS161K04 pGCAP10 NM_004127.4  
GGGGTGNNAGATGCCTCTGCCGGNTCANGTGTTNAANTTGCANGGGGCCNTGNANCCCAT
HKR327749 RBb19G05 pKA1U5 NM_004127.4  
GGGACGGCACGCCGCGGCGGGGTGGGTGCAAGATGCCGCTGCCGGTTCAGGTGTTTAACT
HKR347779 RBb69H11 pGCAP1 NM_004127.4  
GGAACGGCACGCCGCGGCGGGGTGGGTGCAAGATGCCGCTGCCGGTTCAGGTGTTTAACT
HKR368501 RBd21E05 pGCAP10 NM_004127.4  
GGCCCCGGAAGTGGACGGCACGCCGCGGCGGGGTGGGTGCAAGATGCCGCTGCCGGTTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl