Prev. | 

RIKEN DNA Bank Human Resource - GPM6A

Gene ID NCBI Gene 2823 |  KEGG hsa:2823
Gene Symbol GPM6A
Protein Name glycoprotein M6A
Synonyms GPM6|M6A
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY012959 IRAK032G15 pBluescriptR BC022508 NM_201591 Full
HGY012974 IRAK032H06 pBluescriptR BC022528 NM_201591 Full
HGY029326 IRAK073F06 pBluescriptR BC032904 NM_201592 Partial/var
HGY042586 IRAK106H18 pBluescript BC044612 NM_201591 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068905 ARe72E09 pKA1U5 NM_201592.1  
GAGGGCGCGAGGAGCCTCAGCGCGGCTTGGAGAACTTGGCCCCGCGCAGCGTCTGGTCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl