Prev. |  KEGG KO K01810 > 

RIKEN DNA Bank Human Resource - GPI

Gene ID NCBI Gene 2821 |  KEGG hsa:2821
Gene Symbol GPI
Protein Name glucose-6-phosphate isomerase
Synonyms AMF|GNPI|NLK|PGI|PHI|SA-36|SA36
Ortholog resources KEGG ortholog (KEGG orthology K01810) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083870 IRAL009L06 pOTB7 BC004982 NM_000175 Full
HGY086820 IRAL017A20 pOTB7 BC006342 NM_000175 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE020136 W01A050F16 pENTR-TOPO flj0055o04 AK129884 NM_000175  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050552 ARe26G08 pKA1U5 NM_000175.2  
GCTCCTCGGCTCGCGTCTCACTCAGTGTACCTTCTAGTCCCGCCATGGCCGCTCTCACCC
HKR051673 ARe29D01 pKA1U5 NM_000175.2  
GGCCGCCGCGCGCCCACGCGCCTCGCTTGCTGCNCGCTGCCGGCGCTCCTTCCTCCTCGG
HKR053225 ARe33B01 pKA1U5 NM_000175.2  
GAGAGAGGAGCTGAGGCCCCAGATCAGCGGCCGCGGGCAAGGTCGCTCAGCGGGCACCCG
HKR054426 ARe36B02 pKA1U5 NM_000175.2  
GGCGCGCCCACGCGCCTCGCTTGCTGCGCGCTGCCGGCGCTCCTTCCTCCTCGGCTCGCG
HKR056175 ARe40H07 pKA1U5 NM_000175.2  
GAGAGGAGCTGAGGCCCCAGATCAGCGGCCGCGGGCTAGTCCCGCCATGGCCGCTCTCAC
HKR063345 ARe58G01 pKA1U5 NM_000175.2  
GCTCCTCGGCTCGCGTCTCACTCAGTGTACCTTCTAGTCCCGCCATGGCCGCTCTCACCC
HKR078580 ARe96H12 pKA1U5 NM_000175.2  
GAGAGGAGCTGAGGCCCCAGATCAGCGGCCGCGGGCAAGGTCGCTCAGCGGGCACCCGGC
HKR172408 ARi31A08 pGCAP10 NM_000175.2  
GGCTTGCTGCGCGCTGCCGGCGCTCCTTCCTCCTCGGCTCGCGTCTCACTCAGTGTACCT
HKR179205 ARi48A05 pGCAP10 NM_000175.2  
GCTCGGCTCGCGTCTCACTCAGTGTACCTTCTAGTCCCGCCATGGCCGCTCTCACCCGGG
HKR180855 ARi52C07 pGCAP10 NM_000175.2  
GGCTTGCTGCGCGCTGCCGGCGCTCCTTCCTCCTCGGCTCGCGTCTCACTCAGTGTACCT
HKR181251 ARi53C03 pGCAP10 NM_000175.2  
CGGCCGGCCGATGGCTTGCTGCGCGCTGCCGGCGCTCCTTCCTCCTCGGCTCGCGTCTCA
HKR205476 ARiS013L12 pGCAP10 NM_000175.2  
GGCTTGCTGCGCGCTGCCGGCGCTCCTTCCTCCTCGGCTCGCGTCTCACTCAGTGTACCT
HKR222350 ARiS055O14 pGCAP10 NM_000175.2  
GGCTTGCTGCGCGCTGCCGGCGCTCCTTCCTCCTCGGCTCGCGTCTCACTCAGTGTACCT
HKR234140 ARiS085F20 pGCAP10 NM_000175.2  
GGCTTGCTGCGCGCTGCCGGCGCTCCTTCCTCCTCGGCTCGCGTCTCACTCAGTGTACCT
HKR340054 RBb50C06 pGCAP1 NM_000175.2  
GGCGCGCTTGCCGGCGCCTCCTTCCTCCTCGGCTCGCGTCTCACNTCAGTGTACCTTCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.09.11

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl