Prev. |  KEGG KO K00006 > 

RIKEN DNA Bank Human Resource - GPD1

Gene ID NCBI Gene 2819 |  KEGG hsa:2819
Gene Symbol GPD1
Protein Name glycerol-3-phosphate dehydrogenase 1
Synonyms GPD-C|GPDH-C|HTGTI
Ortholog resource in our bank

  GPD1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX019970 IRAK049P10 pCMV-SPORT6 BC032234 NM_005276
HGY095535 IRAL038N23 pDNR-LIB BC017429 NM_005276 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR376836 RBd42B12 pGCAP10 NM_005276.2  
GGTGTGGTGGAGTTAAATGCTCCTAGCCGGCAGAGGAGCTAGGGAGTGTGGCACTGAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl