DNA Bank Top |  KEGG KO K08107 > 

RIKEN DNA Bank Human Resource - GPC1

Gene ID NCBI Gene 2817 |  KEGG hsa:2817
Gene Symbol GPC1
Protein Name glypican 1
Synonyms glypican

Link

Ortholog resource in our bank

  GPC1


External database

human GPC1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB20345 human glypican-1 in pcDNA3.1(+) Expression vector of the soluble ectodomain of human glypican-1.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007750 IRAK019G06 pCMV-SPORT6 BC008123 NM_002081 Partial/var
HGY099003 IRAL047I11 pOTB7 BC051279 NM_002081 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR348005 RBb70A05 pGCAP1 NM_002081.2  
TGGGGCCGCCTCTGGACCGCGAGCCGCGCGCGCCGGGACCTTGGCTCTGCCCTTCGCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl