Prev. |  KEGG KO K14455 > 

RIKEN DNA Bank Human Resource - GOT2

Gene ID NCBI Gene 2806 |  KEGG hsa:2806
Gene Symbol GOT2
Protein Name glutamic-oxaloacetic transaminase 2
Synonyms KAT4|KATIV|KYAT4|mitAAT
Ortholog resource in our bank

  GOT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080678 IRAL001L14 pOTB7 BC000525 NM_002080 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205352 ARiS013G08 pGCAP10 NM_002080.2  
GAGTCCCTGTCCTTACCTTCAGCAGGAGCCGGTTCCCTGTGTGTGTGTCCGCTCGCCCTC
HKR326930 RBb17F10 pKA1U5 NM_002080.2  
GGTGTGTGTCCGCTCGCCCTCTGCTCCGTCCTGCGGCTGCCCACTGCCCTCCTACGGTCC
HKR346970 RBb67H02 pGCAP1 NM_002080.2  
GGTCCCTGTCCTTACCTTCAGCAGGAGCCGGTTCCCTGTGTGTGTGTCCGCTCGCCCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl