Prev. |  KEGG KO K14454 > 

RIKEN DNA Bank Human Resource - GOT1

Gene ID NCBI Gene 2805 |  KEGG hsa:2805
Gene Symbol GOT1
Protein Name glutamic-oxaloacetic transaminase 1
Synonyms AST1|ASTQTL1|GIG18|cAspAT|cCAT
Ortholog resources KEGG ortholog (KEGG orthology K14454) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080490 IRAL001D18 pOTB7 BC000498 NM_002079 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058030 ARe45B06 pKA1U5 NM_002079.1  
GGGGCCCGCCCCCGCCGGCTAGGTGAAGGTGAGTGTCTCCTCCAGTCGCAACGGCCAGAC
HKR188172 ARi70H04 pGCAP10 NM_002079.1  
GGGGCGTGGGGTGAAATCTCTTGATTCCTAGTCTCTCGATATGGCACCTCCGTCAGTCTT
HKR360825 RBd02B01 pGCAP10 NM_002079.1  
GAATCGCGTTGCCAAGCTTTGGACGCGGCTCGACCATTGGAGGCCGCGGGCCCGCCCCCG
HKR390174 RBd75H06 pGCAP10 NM_002079.1  
GGTCTCCTCCAGTCGCAACGGCCAGACCTGACCTGCCAGCTCCGGGCGTGGGGTGAAATC
HKR399774 RBd99H06 pGCAP10 NM_002079.1  
GGTCTCCTCCAGTCGCAACGGCCAGACCTGACCTGCCAGCTCCGGGCGTGGGGTGAAATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl