DNA Bank Top |  KEGG KO K20478 > 

RIKEN DNA Bank Human Resource - GOLGB1

Gene ID NCBI Gene 2804 |  KEGG hsa:2804
Gene Symbol GOLGB1
Protein Name golgin B1
Synonyms GCP|GCP372|GOLIM1

Link

Ortholog resource in our bank

  GOLGB1

External database

human GOLGB1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB20222 pcDNA3/td5StayGold(c4)=GianCreg Expression vector of td5StayGold for labeling the Golgi apparatus.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056268 IRAK140L04 pCMV-SPORT6 BC065301 NM_004487 Partial/var
HGY099320 IRAL048E24 pDNR-LIB BC057227

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR264561 ARiS161G17 pGCAP10 NM_001256486.2 full/var done
GGAGTCCCTGGCGGGGCGCGGCGGTGGAAGGTGTCGCGTACGGGCTTCCCGAGCTGACGT
HKR416167 RBdS040G23 pGCAP10 NM_001256488.2 full cds  
GGAGTCCCTGGCGGGGCGCGGCGGTGGAAGGTGTCGCGTACGGGCTTCCCGAGCTGACGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2025.03.28

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl