Prev. |  KEGG KO K20478 > 

RIKEN DNA Bank Human Resource - GOLGB1

Gene ID NCBI Gene 2804 |  KEGG hsa:2804
Gene Symbol GOLGB1
Protein Name golgin B1
Synonyms GCP|GCP372|GOLIM1
Ortholog resources KEGG ortholog (KEGG orthology K20478) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056268 IRAK140L04 pCMV-SPORT6 BC065301 NM_004487 Partial/var
HGY099320 IRAL048E24 pDNR-LIB BC057227

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR264561 ARiS161G17 pGCAP10 NM_004487.3 done
GGAGTCCCTGGCGGGGCGCGGCGGTGGAAGGTGTCGCGTACGGGCTTCCCGAGCTGACGT
HKR416167 RBdS040G23 pGCAP10 NM_004487.3  
GGAGTCCCTGGCGGGGCGCGGCGGTGGAAGGTGTCGCGTACGGGCTTCCCGAGCTGACGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl