Prev. |  KEGG KO K01137 > 

RIKEN DNA Bank Human Resource - GNS

Gene ID NCBI Gene 2799 |  KEGG hsa:2799
Gene Symbol GNS
Protein Name glucosamine (N-acetyl)-6-sulfatase
Synonyms G6S
Featured content Lysosome (human)
Ortholog resource in our bank

  GNS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011400 IRAK028I08 pCMV-SPORT6 BC012482 NM_002076 Full
HGX010819 IRAK027A19 pCMV-SPORT6 BC017742 NM_002076 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE092803 M01C032A03 pDONR221 MGC05-E02 BC012482 NM_002076  
HGE092851 M01C032C03 pDONR221 MGC05-E02 BC012482 NM_002076  
HGE092899 M01C032E03 pDONR221 MGC05-E02 BC012482 NM_002076  
HGE092947 M01C032G03 pDONR221 MGC05-E02 BC012482 NM_002076  
HGE092995 M01C032I03 pDONR221 MGC05-E02 BC012482 NM_002076  
HGE093043 M01C032K03 pDONR221 MGC05-E02 BC012482 NM_002076  
HGE093091 M01C032M03 pDONR221 MGC05-E02 BC012482 NM_002076  
HGE093139 M01C032O03 pDONR221 MGC05-E02 BC012482 NM_002076  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041503 W01A103M15 pENTR-TOPO IRAK028I08 BC012482 NM_002076  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070131 ARe75F11 pKA1U5 NM_002076.3  
ATCCTGGGNCTAGGGAGAAAACGTCTGACTCCCCNTNAANGCCTTCAAGGCACGGCTTTT
HKR209274 ARiS023D02 pGCAP10 NM_002076.3  
GAAGGCACGGCTTTTTATTCCTTCGGCTGGTCGGCCTCTCGCCCTTCAGCTACCTGTGCG
HKR209347 ARiS023G03 pGCAP10 NM_002076.3  
GGATCGCGCCTAGGGAGAAAACGTCTGACTCCAGCCACCGGCCTTCAAGGCACGGCTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl