Prev. | 

RIKEN DNA Bank Human Resource - GNL1

Gene ID NCBI Gene 2794 |  KEGG hsa:2794
Gene Symbol GNL1
Protein Name G protein nucleolar 1 (putative)
Synonyms HSR1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010534 IRAK026F14 pCMV-SPORT6 BC018366 NM_005275 Full
HGX053967 IRAK134P07 pCMV-SPORT6 BC063657 NM_005275 Partial
HGY084369 IRAL010P09 pOTB7 BC013959 NM_005275 Full
HGY086822 IRAL017A22 pOTB7 BC006343 NM_005275 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR367625 RBd19B01 pGCAP10 NM_005275.2  
GGTCAGTTGAGGCGGCGGGAGCTCGGCGGAGGGCGGGCCAGGTGACTGGTCCGGGCCATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl