Prev. |  KEGG KO K04546 > 

RIKEN DNA Bank Human Resource - GNG11

Gene ID NCBI Gene 2791 |  KEGG hsa:2791
Gene Symbol GNG11
Protein Name G protein subunit gamma 11
Synonyms GNGT11
Ortholog resources KEGG ortholog (KEGG orthology K04546) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005692 IRAK014D20 pCMV-SPORT6 BC009709 NM_004126 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE035937 W01A089O01 pENTR-TOPO IRAK014D20 BC009709 NM_004126  
HGE035939 W01A089O03 pENTR-TOPO IRAK014D20 BC009709 NM_004126  
HGE035941 W01A089O05 pENTR-TOPO IRAK014D20 BC009709 NM_004126  
HGE035943 W01A089O07 pENTR-TOPO IRAK014D20 BC009709 NM_004126  
HGE035945 W01A089O09 pENTR-TOPO IRAK014D20 BC009709 NM_004126  
HGE035955 W01A089O19 pENTR-TOPO IRAK014D20 BC009709 NM_004126  
HGE035959 W01A089O23 pENTR-TOPO IRAK014D20 BC009709 NM_004126  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044079 ARe10D07 pKA1U5 NM_004126.3  
GAGCATCCCTGCTGGGCGATTGAGCAGCGGGAAGCTGCTTGGACCCAGTCTCAAACTTAA
HKR075650 ARe89C02 pKA1U5 NM_004126.3  
GGCTGTTCCCAGTCCTGCAGCCCCAGCCCAGCCGTCCCCCGCGGGCGTGGCAGGTCCTGA
HKR166476 ARi16D04 pGCAP10 NM_004126.3  
GAGTTGTTTCGGGACGCGCCGAGCTTCGCCGCTCTTCCAGCGGCTCCGCTGCCAGAGCTA
HKR368977 RBd22H09 pGCAP10 NM_004126.3  
GAGAATTGTTAAGAGAGAGAGCTCATATGAAATTGGTTATCGTGGGATATTTAAAATAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl