Prev. |  KEGG KO K04545 > 

RIKEN DNA Bank Human Resource - GNG10

Gene ID NCBI Gene 2790 |  KEGG hsa:2790
Gene Symbol GNG10
Protein Name G protein subunit gamma 10
Synonyms -
Ortholog resource in our bank

  GNG10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008837 IRAK022B13 pCMV-SPORT6 BC015206 NM_001017998 Full
HGX069697 IRAK174E01 pCMV-SPORT6 BC072671 NM_001017998 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE010015 W01A025A15 pENTR-TOPO X01Y101A11 BC010384  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049684 ARe24D12 pKA1U5 NM_001017998.2  
GAGCCCCTAGGAGCCCAGCGCCGCCGCCATGTCCTCCGGGGCTAGCGCGAGCGCCCTGCA
HKR078969 ARe97H01 pKA1U5 NM_001017998.2  
GAGCCCCTAGGAGCCCAGCGCCGCCGCCATGTCCTCCGGGGCTAGCGCGAGCGCCCTGCA
HKR164860 ARi12C12 pGCAP10 NM_001017998.2  
GAGCAGCCCCTAGGAGCCCAGCGCCGCCGCCATGTCCTCCGGGGCTAGCGCGAGCGCCCT
HKR209345 ARiS023G01 pGCAP10 NM_001017998.2  
GAGGAGCCCAGCGCCGCCGCCATGTCCTCCGGGGCTAGCGCGAGCGCCCTGCAGCGCTTG
HKR222040 ARiS055B16 pGCAP10 NM_001017998.2  
GAGGAGCCCAGCGCCGCCGCCATGTCCTCCGGGGCTAGCGCGAGCGCCCTGCAGCGCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl