Prev. |  KEGG KO K04537 > 

RIKEN DNA Bank Human Resource - GNB2

Gene ID NCBI Gene 2783 |  KEGG hsa:2783
Gene Symbol GNB2
Protein Name G protein subunit beta 2
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K04537) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056118 IRAK140E22 pCMV-SPORT6 BC068003 NM_005273 Full
HGY091137 IRAL027O01 pOTB7 BC010073 NM_005273 Full
HGY091682 IRAL029D10 pOTB7 BC012348 NM_005273 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE034641 W01A086K01 pENTR-TOPO IRAL027O01 BC010073 NM_005273  
HGE034643 W01A086K03 pENTR-TOPO IRAL027O01 BC010073 NM_005273  
HGE034649 W01A086K09 pENTR-TOPO IRAL027O01 BC010073 NM_005273  
HGE034653 W01A086K13 pENTR-TOPO IRAL027O01 BC010073 NM_005273  
HGE034661 W01A086K21 pENTR-TOPO IRAL027O01 BC010073 NM_005273  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047726 ARe19F06 pKA1U5 NM_005273.3  
GGGCAGCGCTGGCGGCGGGGCTGGGGCCACTGCAGGAAATCCATCCGCGCCGCCGCCGCC
HKR058522 ARe46F02 pKA1U5 NM_005273.3  
TGACTGGCGGGCGGGATCCCTCCGCTCTGGGGAGGCAGCGCTGGCGGCGGGGCTGGGGCC
HKR164002 ARi10A02 pGCAP10 NM_005273.3  
GGCGGAGGAAGACAGCGCCGCCCGCGCACCGCCAGCGACCCCCGCCGCAGAGTCCCACCG
HKR234203 ARiS085I11 pGCAP10 NM_005273.3  
GATATGCCAGTACCACCTCCTCCAGTCCCAGAGGGGGGATGTCTTACTCCTTTCCGTGAA
HKR234301 ARiS085M13 pGCAP10 NM_005273.3  
GGCCGCCGCCGCCGCCGCCTCCGCCGCGGAGGAAGACAGCGCCGCCCGCGCACCGCCAGC
HKR247325 ARiS118F05 pGCAP10 NM_005273.3  
GGCCCGCNCANCNCCAGCNACCCCCNCCGCANANTCNNACCGCCACAGGCCTCGGGCCAG
HKR332546 RBb31G02 pGCAP1 NM_005273.3  
HKR391278 RBd78D06 pGCAP10 NM_005273.3  
GAAATCCATCCGCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCTCCGCCGCGGAGGAAGA
HKR444227 RBdS110J11 pGCAP10 NM_005273.3  
GGAGGAAATCCATCCGCGCCGCCGCCGCCGCCGCCGCCGCCGCCGCCTCCGCCGCGGAGG
HKR461950 RBdS154O14 pGCAP10 NM_005273.3  
GGAGGAAGACAGCGCCGCCCGCGCACCGCCAGCGACCCCCGCCGCAGAGTCCCACCGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl