Prev. |  KEGG KO K04536 > 

RIKEN DNA Bank Human Resource - GNB1

Gene ID NCBI Gene 2782 |  KEGG hsa:2782
Gene Symbol GNB1
Protein Name G protein subunit beta 1
Synonyms MRD42
Ortholog resources KEGG ortholog (KEGG orthology K04536) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX004893 IRAK012D21 pCMV-SPORT6 BC008991 NM_002074 Full
HGY081136 IRAL002N24 pOTB7 BC004186 NM_002074 Full
HGY084590 IRAL011H22 pOTB7 BC005888 NM_002074 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR063206 ARe58A06 pKA1U5 NM_002074.2  
GGCGCCCATCCCGATGGCTGGAGGCGTCTGACCNNTNGACGGAGGCGGCGGCGGCGAGCG
HKR172904 ARi32E08 pGCAP10 NM_002074.2  
GTTTCCGAGGCTGCGGGCAGGGGCCCGCCGCGCCCATCCCGATGGCTGGAGGCGTCTGAG
HKR209317 ARiS023E21 pGCAP10 NM_002074.2  
GATCCCGATGGCTGGAgGCgTCtGAgGGGCGGAgGGAgGCGGCGGCGGCGGCGGCGGGAG
HKR209392 ARiS023H24 pGCAP10 NM_002074.2  
GAGGGGCCCGCCGCGCCCATCCCGATGGCTGGAGGCGTCTGAGGGGCGGACGGAGGCGGC
HKR347227 RBb68B03 pGCAP1 NM_002074.2  
GGCGGACGGAGGCGGCGGCGGCGGCGGCGGGAGCGGGAGCGGGCGGCGAGTGGGGAGCGG
HKR364106 RBd10E10 pGCAP10 NM_002074.2  
GGCGGTGTGCGTGGTGACGCGAGCGCCTGGGGTTTTCCGAGGCTGCGGGCAGGGGNCNGC
HKR383330 RBd58F10 pGCAP10 NM_002074.2  
GATCCCGATGNCTGNNNNGNGTCTGAGGGGCGNANNGATGNNNNNNNTGCNCNNCNNGNA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl