Prev. |  KEGG KO K04632 > 

RIKEN DNA Bank Human Resource - GNAS

Gene ID NCBI Gene 2778 |  KEGG hsa:2778
Gene Symbol GNAS
Protein Name GNAS complex locus
Synonyms AHO|C20orf45|GNAS1|GPSA|GSA|GSP|NESP|PITA3|POH|SCG6|SgVI
Ortholog resources KEGG ortholog (KEGG orthology K04632) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY092835 IRAL032B11 pDNR-LIB BC022875 NM_080426 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE019780 W01A049H12 pENTR-TOPO flj0057c22 AK026564 NM_000516 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046953 ARe17G09 pKA1U5 NM_000516.4  
GGCTGCCCCGGCCCTCCCGGCCCGCGTGAGGCCCCNTTNAGCCCGCCGCCGCCGCAGCCC
HKR053351 ARe33G07 pKA1U5 NM_000516.4  
GCTCCCAGCCGCCGCCGCCGCCGCGGCCGCTCCTCNNNNCTCCTCCTCCTCCTCCTCCTT
HKR081698 ARf04E02 pKA1U5 NM_000516.4  
GGCAGTCCGCCCCGCGCGCTCCTTGCCGAGGAGCCGAGCCCGCGCCCGGCCCGCCCGCCC
HKR172053 ARi30C05 pGCAP10 NM_000516.4  
TTTTCGGTCCGCGCGCCCCGCCGCCCGCGGCCCGCAGTCCGCCCCGCGCGCTCCTTGCCG
HKR183256 ARi58C08 pGCAP10 NM_000516.4  
GAGCAGCTCCCGCAGCTCCTGCTCTGGTCCGCCTCGGCCCGGCGGCGGCCATCAGCCCCC
HKR247419 ARiS118J03 pGCAP10 NM_000516.4  
GAGAGGCGCCTTCGGCTCGGGCCATGGCGCCCGGCGCCGGGGGCGCGAGGAGCGGCTCAT
HKR335208 RBb38A08 pGCAP1 NM_000516.4  
HKR364811 RBd12A11 pGCAP10 NM_000516.4  
HKR365282 RBd13D10 pGCAP10 NM_000516.4  
HKR369724 RBd24F04 pGCAP10 NM_000516.4  
GAGCNCTTNCCCGCAGCTCCTGCTCTGGTCCGCCTCGGCCCGGCGGCGGCCATCAGCCCC
HKR375274 RBd38D02 pGCAP10 NM_000516.4  
GAGCAGCTCCCGCAGCTCCTGCTCTGGTCCGCCTCGGCCCGGCGGCGGCCATCAGCCCCC
HKR375745 RBd39G01 pGCAP10 NM_000516.4  
GAGCAGCTCCCGCAGCTCCTGCTCTGGTCCGCCTCGGCCCGGCGGCGGCCATCAGCCCCC
HKR377701 RBd44E05 pGCAP10 NM_000516.4  
GACTCAGTCGCGTCGGCACCGCGGAGCGGGCTGCGTCAGGTGGCTGGCCGGCGCGGCGCT
HKR378078 RBd45D06 pGCAP10 NM_000516.4  
GAGCACCTCCCGCAGCTCCTGCTCTGGTCCGCCTCGGCCCGGCGGCGGCCATCAGCCCCC
HKR380806 RBd52A06 pGCAP10 NM_000516.4  
GAATAAGAGCGGCGGGGGCGGCAGGGGCGGGGGCCTCTCCCGCGGCCCCGGCTCTGGTCC
HKR381703 RBd54E07 pGCAP10 NM_000516.4  
AGCAGCTCCCGCANCTCCTGCTCTGGTCCGCCTCGGCCCGGCNNTTTGCCATCAGCCCCC
HKR393379 RBd83H11 pGCAP10 NM_000516.4  
GAGCNNNTCCCGCAGCTCCTGCTCTGGTCCGCCTCGGCCCGGCGGCGGCCATCAGCCCCC
HKR396178 RBd90H10 pGCAP10 NM_000516.4  
GAGCAGCTCCCGCAGCTCCTGCTCTGGTCCGCCTCGGCCCGGCGGCGGCCATCAGCCCCC
HKR399626 RBd99B02 pGCAP10 NM_000516.4  
GAGCAGCTCCCGCAGCTCCTGCTCTGGTCCGCCTCGGCCCGGCGGCGGCCATCAGCCCCC
HKR405717 RBdS014E21 pGCAP10 NM_000516.4  
GAATAAGAGCGGCGGCGGCGGCAGCGGCGGCAGCAGCTCCCGCAGCTCCTGCTCTGGTCC
HKR416230 RBdS040J14 pGCAP10 NM_000516.4  
GNNCTNGGGGCGGCNGCGGGGGCCCGGCCGANGCAATAAGAGCGGCGGCGGCGGCANCAG
HKR442152 RBdS105G08 pGCAP10 NM_000516.4  
GAGCNGCTCCCGCNGCTCCTGCTCTGGTCCGCCTCGGCCCGGCGGCGGCCATCAGCCCCC
HKR453142 RBdS132O06 pGCAP10 NM_000516.4  
GAGAGCGGCGGCGGCGGCAACGGCGGCANCANCTCCCGCAGCTCCTGCTCTGGTCCGCCT
HKR461965 RBdS154P05 pGCAP10 NM_000516.4  
GCCCCGCCCGTCCGCNCGCCCCGNGGCCCGCGGCCCGCAGTCCGCCCCGCGCGCTCCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl