Prev. |  KEGG KO K04630 > 

RIKEN DNA Bank Human Resource - GNAI3

Gene ID NCBI Gene 2773 |  KEGG hsa:2773
Gene Symbol GNAI3
Protein Name G protein subunit alpha i3
Synonyms 87U6|ARCND1
Featured content Sphingolipid signaling pathway (human)
Featured content Axon guidance - human
Featured content Parkinson disease - human
Ortholog resource in our bank

  GNAI3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY097147 IRAL042O11 pOTB7 BC025285 NM_006496 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE019739 W01A049F19 pENTR-TOPO IRAL042O11 BC025285 NM_006496  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178176 ARi45H08 pGCAP10 NM_006496.2  
GCTTTTGGCCGCTGGCGGAGATCACGGAGAGGACCCCCTCCCAGCCTCGGACAGTCTCTC
HKR264753 ARiS161O17 pGCAP10 NM_006496.2  
GAAGGGAGCTGACGGAGAGGGCCACCGCCCAGCAATAGACGGTGCCTCAGCCTGCCGAGC
HKR341273 RBb53D01 pGCAP1 NM_006496.2  
GGACGGAGAGGGCCACCGCCCAGCAATAGACGGTGCCTCAGCCTGCCGAGCCGCAGTTTC
HKR471009 RBdS177I17 pGCAP10 NM_006496.2  
GGACGGAGAGGGCCACCGCCCAGCAATAGACGGTGCCTCAGCCTGCCGAGCCGCAGTTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl