Prev. |  KEGG KO K04630 > 

RIKEN DNA Bank Human Resource - GNAI2

Gene ID NCBI Gene 2771 |  KEGG hsa:2771
Gene Symbol GNAI2
Protein Name G protein subunit alpha i2
Synonyms GIP|GNAI2B|H_LUCA15.1|H_LUCA16.1
Featured content Sphingolipid signaling pathway (human)
Featured content Axon guidance - human
Featured content Parkinson disease - human
Ortholog resource in our bank

  GNAI2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010962 IRAK027G18 pCMV-SPORT6 BC016995 NM_002070 Partial
HGY084231 IRAL010J15 pOTB7 BC014627 NM_002070 Full/var
HGY091730 IRAL029F10 pOTB7 BC012138 NM_002070 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE031926 W01A079N14 pENTR-TOPO IRAL029F10 BC012138 NM_002070  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066459 ARe66C11 pKA1U5 NM_002070.2  
GACTGCCGACCCGAGTGCTTCCCGCAGAGGGCTGGTGGTGGGAGCGGAGTGGGTCGGGCG
HKR174902 ARi37E06 pGCAP10 NM_002070.2  
GAGTCGCTCGGAACTGCCGACCCGAGTGCTTCCCGCAGAGGGCTGGTGGTGGGAGCGGAG
HKR323230 RBb08B06 pKA1U5 NM_002070.2  
GGCTCGGAACTGCCGACCCGAGTGCTTCCCGCAGAGGGCTGGTGGTGGGAGCGGAGTGGG
HKR416053 RBdS040C05 pGCAP10 NM_002070.2  
GGAGTGCTTCCCGCAGAGGGCTGGTGGTGGGAGCGGAGTGGGTCGGGCGGGGCCGAGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl