Prev. |  KEGG KO K04630 > 

RIKEN DNA Bank Human Resource - GNAI1

Gene ID NCBI Gene 2770 |  KEGG hsa:2770
Gene Symbol GNAI1
Protein Name G protein subunit alpha i1
Synonyms Gi
Featured content Sphingolipid signaling pathway (human)
Featured content Axon guidance - human
Featured content Parkinson disease - human
Ortholog resource in our bank

  GNAI1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR057277 ARe43D05 pKA1U5 NM_002069.5 done
GACTGTACCCAGAGATTCAAAACCCCAAACCCGGGACTTGGGGGCGCTGAGCCGGGCCGG
HKR277898 ARiS194M10 pGCAP10 NM_002069.5 VA done
GGAGGCTGNGGCGCGGCCACCGGCGGGAGTGCAGCGGCCACTGTACCCAGAGATTCAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl