Prev. |  KEGG KO K04346 > 

RIKEN DNA Bank Human Resource - GNA12

Gene ID NCBI Gene 2768 |  KEGG hsa:2768
Gene Symbol GNA12
Protein Name G protein subunit alpha 12
Synonyms NNX3|RMP|gep
Featured content Sphingolipid signaling pathway (human)
Ortholog resource in our bank

  GNA12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY089646 IRAL024B22 pOTB7 BC007400 NM_007353

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172905 ARi32E09 pGCAP10 NM_007353.2  
GGGCGGCGGCGGACGCGGCCTGAGGCGAGCGGCGGGGCGTGGGGCGGTGCCTCGGCCCGG
HKR234904 ARiS087E08 pGCAP10 NM_007353.2  
GGCCCTGCCCGGCCCGCCCTGCNAGTCANTTCNNTGGTTCCCTCCCTCCCTGGGCGCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl