Prev. |  KEGG KO K01915 > 

RIKEN DNA Bank Human Resource - GLUL

Gene ID NCBI Gene 2752 |  KEGG hsa:2752
Gene Symbol GLUL
Protein Name glutamate-ammonia ligase
Synonyms GLNS|GS|PIG43|PIG59
Ortholog resources KEGG ortholog (KEGG orthology K01915) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY029081 IRAK072L17 pBluescriptR BC031964 NM_002065 Full/var
HGY090915 IRAL027E19 pOTB7 BC010037 NM_002065 Full
HGY090893 IRAL027D21 pOTB7 BC011700 NM_002065 Full
HGY091246 IRAL028B22 pOTB7 BC018992 NM_002065 Full
HGY091451 IRAL028K11 pOTB7 BC011852 NM_002065 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064026 ARe60B02 pKA1U5 NM_002065.4  
GGCGGATAAAGGGTGCGGGGCTGCTGGCGGCCCTGCAGAGTCGAGAGTGGGAGAAGAGCG
HKR069634 ARe74B10 pKA1U5 NM_002065.4  
GAGAGTCGAGAGTGGGAGAAGAGCGGAGCGTGNGAGCAGTACTGCGGCCTCCTCTCCTCT
HKR161301 ARi03E05 pGCAP10 NM_002065.4  
GAGAGTCGAGAGTGGGAGAAGAGCGGAGCGTGTGAGCAGTACTGCGGCCTCCTCTCCTCT
HKR209265 ARiS023C17 pGCAP10 NM_002065.4  
GAGTGGTTTGTTTGCGCTGTGGATGGAGTGGCGGTGCGGTCCCCTGTGGAGCGCAAACAA
HKR249005 ARiS122I13 pGCAP10 NM_002065.4  
GAGAGTCGAGAGTGGGANAANAGCGGAGCGTGTGAGCAGTACTGCGGCCTCCTCTCCTCT
HKR374802 RBd37A02 pGCAP10 NM_002065.4  
GAGAGTCGAGAGTGGGAGAAGAGCGGAGCGTGTGAGCAGTACTGCGGCCTCCTCTCCTCT
HKR384921 RBd62F01 pGCAP10 NM_002065.4  
GGCAGAGTCGAGAGTGGGAGAAGAGCGGAGCGTGTGAGCAGTACTGCGGCCTCCTCTCCT
HKR387721 RBd69F01 pGCAP10 NM_002065.4  
GGCAGAGTCGAGAGTGGGAGAAGAGCGGAGCGTGTGAGCAGTACTGCGGCCTCCTCTCCT
HKR394569 RBd86H01 pGCAP10 NM_002065.4  
GAGAGTCGAGAGTGGGAGAAGAGCGGAGCGTGTGAGCAGTACTGCGGCCTCCTCTCCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl