Prev. |  KEGG KO K00261 > 

RIKEN DNA Bank Human Resource - GLUD1

Gene ID NCBI Gene 2746 |  KEGG hsa:2746
Gene Symbol GLUD1
Protein Name glutamate dehydrogenase 1
Synonyms GDH|GDH1|GLUD
Ortholog resources KEGG ortholog (KEGG orthology K00261) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033825 IRAK084J09 pCMV-SPORT6 BC040132 NM_005271 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051605 ARe29A05 pKA1U5 NM_005271.2  
GGAAAGCGCGCCTGTTTCGCGACCATCACGCACCTCCCCTCCGCTTGTGGCCATGTACCG
HKR060570 ARe51H02 pKA1U5 NM_005271.2  
GGAGGGGACAGCCGGGCAAGCAGGAAGCTGCGGCTTAAAAGGGCAACCCGCGCGGGACCC
HKR209513 ARiS023N01 pGCAP10 NM_005271.2  
GCTCCCTAGTCGCGGGGAGTCTGAGAAAGCGCGCCTGTTTCGCGACCATCACGCACCTCC
HKR243767 ARiS109G23 pGCAP10 NM_005271.2  
GAAGCAGGAAGCTGCGGCTTAAAAGGGCAACCCGCGCGGGACCCTTCCTCCCTAGTCGCG
HKR342546 RBb56G02 pGCAP1 NM_005271.2  
TGCCCGTTAGGTGGCGAGCGCCCGAGGGGAGGGGACAGCCNGGCAAGCAGGAAGCTGCGG
HKR374929 RBd37F09 pGCAP10 NM_005271.2  
GGAAGCGCTGTTGCTGTCCCGGGCCGGGCCCGCTGCCCTGGGCTCGGCGTCCGCCGACTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl