Prev. |  KEGG KO K03676 > 

RIKEN DNA Bank Human Resource - GLRX

Gene ID NCBI Gene 2745 |  KEGG hsa:2745
Gene Symbol GLRX
Protein Name glutaredoxin
Synonyms GRX|GRX1
Ortholog resource in our bank

  GLRX

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086549 IRAL016G05 pDNR-LIB BC005304 NM_002064 Full
HGY087971 IRAL019P11 pDNR-LIB BC010965 NM_002064 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096413 M01C041A13 pDONR221 MGC10-A07 BC005304 NM_002064  
HGE096461 M01C041C13 pDONR221 MGC10-A07 BC005304 NM_002064  
HGE096509 M01C041E13 pDONR221 MGC10-A07 BC005304 NM_002064  
HGE096557 M01C041G13 pDONR221 MGC10-A07 BC005304 NM_002064  
HGE096605 M01C041I13 pDONR221 MGC10-A07 BC005304 NM_002064  
HGE096653 M01C041K13 pDONR221 MGC10-A07 BC005304 NM_002064  
HGE096701 M01C041M13 pDONR221 MGC10-A07 BC005304 NM_002064  
HGE096749 M01C041O13 pDONR221 MGC10-A07 BC005304 NM_002064  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166523 ARi16F03 pGCAP10 NM_002064.2  
CGGCCGGCCGATGGAGACCGCAGCCCATCGGCATGGCTCAAGAGTTTGTGAACTGCAAAA
HKR218226 ARiS045J10 pGCAP10 NM_002064.2  
CNGGATTCTTCCCGGGGAGACCGCAGCCCATCGGCATGGCTCAAGAGTTTGTGAACTGCA
HKR218311 ARiS045M23 pGCAP10 NM_002064.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl