Prev. |  KEGG KO K05196 > 

RIKEN DNA Bank Human Resource - GLRB

Gene ID NCBI Gene 2743 |  KEGG hsa:2743
Gene Symbol GLRB
Protein Name glycine receptor beta
Synonyms HKPX2
Ortholog resources KEGG ortholog (KEGG orthology K05196) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027693 IRAK069D21 pCMV-SPORT6 BC032635 NM_000824

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037925 W01A094N13 pENTR-TOPO IRAK069D21 BC032635 NM_000824  
HGE037965 W01A094P05 pENTR-TOPO IRAK069D21 BC032635 NM_000824  
HGE037967 W01A094P07 pENTR-TOPO IRAK069D21 BC032635 NM_000824  
HGE037973 W01A094P13 pENTR-TOPO IRAK069D21 BC032635 NM_000824  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062148 ARe55G04 pKA1U5 NM_000824.3  
GACCCCTAGCAGCCACTGCCACCTGGGCCCGGANCCTCNACGATCTCGCCCGGCGATTGT
HKR222072 ARiS055C24 pGCAP10 NM_000824.3  
GAGCCNAGCTCGGCGGTGGCNCGGGCGGCTGGGACGCAGCTGCCCCCGCTCGGCGCCCGC
HKR264630 ARiS161J14 pGCAP10 NM_000824.3  
GCCCCGCNCGGCGCCCGCTGCACCCTTAGCAGCCACTGCCACCTGGGCCCGGAGCCTCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl