Prev. |  KEGG KO K06816 > 

RIKEN DNA Bank Human Resource - GLG1

Gene ID NCBI Gene 2734 |  KEGG hsa:2734
Gene Symbol GLG1
Protein Name golgi glycoprotein 1
Synonyms CFR-1|ESL-1|MG-160|MG160
Ortholog resources KEGG ortholog (KEGG orthology K06816) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY053555 IRAK133O19 pBluescript BC060822 NM_012201 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR183372 ARi58H04 pGCAP10 NM_012201.5  
GGCCGCGGACTCAAGATGGCGGCGTGTGGACGTGTACGGAGGATGTTCCGCTTGTCGGCG
HKR334903 RBb37E07 pGCAP1 NM_012201.5  
TGGAGTGCGTCGAGCTCGCCGCGGACTCAAGATGGCGGCGCTGTTGGACGTGTACGGAGG
HKR386925 RBd67F05 pGCAP10 NM_012201.5  
AAAGNCNTNNNNNNNNNAAGATGGCGGCGTGTGGACGTGTACGGAGGATGTTCCGCTTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl