Prev. |  KEGG KO K18723 > 

RIKEN DNA Bank Human Resource - GLE1

Gene ID NCBI Gene 2733 |  KEGG hsa:2733
Gene Symbol GLE1
Protein Name GLE1 RNA export mediator
Synonyms CAAHC|CAAHD|GLE1L|LCCS|LCCS1|hGLE1
Ortholog resource in our bank

  GLE1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013733 IRAK034F13 pBluescriptR BC030012 NM_001003722 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE089623 M01C024A23 pDONR221 MGC01-E12 BC030012 NM_001003722  
HGE089671 M01C024C23 pDONR221 MGC01-E12 BC030012 NM_001003722  
HGE089719 M01C024E23 pDONR221 MGC01-E12 BC030012 NM_001003722  
HGE089767 M01C024G23 pDONR221 MGC01-E12 BC030012 NM_001003722  
HGE089815 M01C024I23 pDONR221 MGC01-E12 BC030012 NM_001003722  
HGE089863 M01C024K23 pDONR221 MGC01-E12 BC030012 NM_001003722  
HGE089911 M01C024M23 pDONR221 MGC01-E12 BC030012 NM_001003722  
HGE089959 M01C024O23 pDONR221 MGC01-E12 BC030012 NM_001003722  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056857 ARe42C09 pKA1U5 NM_001499.2  
GGTTTGGTCAGAAGGGGGGCGTCAGAGAAGCTGCCCCTTAGCCAACCATGCCGTCTGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl