Prev. |  KEGG KO K11205 > 

RIKEN DNA Bank Human Resource - GCLM

Gene ID NCBI Gene 2730 |  KEGG hsa:2730
Gene Symbol GCLM
Protein Name glutamate-cysteine ligase modifier subunit
Synonyms GLCLR
Ortholog resources KEGG ortholog (KEGG orthology K11205) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY031137 IRAK077O01 pBluescriptR BC041809 NM_002061 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE090820 M01C027A20 pDONR221 MGC03-B10 BC041809 NM_002061  
HGE090868 M01C027C20 pDONR221 MGC03-B10 BC041809 NM_002061  
HGE090916 M01C027E20 pDONR221 MGC03-B10 BC041809 NM_002061  
HGE090964 M01C027G20 pDONR221 MGC03-B10 BC041809 NM_002061  
HGE091012 M01C027I20 pDONR221 MGC03-B10 BC041809 NM_002061  
HGE091060 M01C027K20 pDONR221 MGC03-B10 BC041809 NM_002061  
HGE091108 M01C027M20 pDONR221 MGC03-B10 BC041809 NM_002061  
HGE091156 M01C027O20 pDONR221 MGC03-B10 BC041809 NM_002061  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR329373 RBb23H05 pGCAP1 NM_002061.2  
GATTCGCGCCCCGCCCCTGCCCCGCCGCGGGATGAGTAACGGTTACGAAGCACTTTCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl