Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GLB1

Gene ID (NCBI) 2720
Gene Symbol GLB1
Protein Name galactosidase, beta 1
Synonyms EBP|ELNR1|MPS4B
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Lysosome (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081563 IRAL003P03 pOTB7 BC007493 NM_000404 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163305 ARi08E09 pGCAP10 NM_000404.2  
GGGGCGCCGACTGCAGAGCCGGGAGGCTGGTGGTCATGCCGGGGTTCCTGGTTCGCATCC
HKR173210 ARi33A10 pGCAP10 NM_000404.2  
GGCGGTGCCAGGCCGTGGGTCCTTAGTCAAGTGACGCGAAGCGGCCGGCCTGGGCGCCGA
HKR182169 ARi55H01 pGCAP10 NM_000404.2  
GGGGCGCCGACTGCAGAGCCGGGAGGCTGGTGGTCATGCCGGGGTTCCTGGTTCGCATCC
HKR238775 ARiS096P15 pGCAP10 NM_000404.2  
GAGTCAAGTGACGCGAAGCGGCCGGCCTGGGCGCCGACTGCAGAGCCGGGAGGCTGGTGG
HKR348834 RBb72B10 pGCAP1 NM_000404.2  
GGCCGACTGCAGAGCCGGGAGGCTGGTGGTCATGCCGGGGTTCCTGGTTCGCATCCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl