Prev. |  KEGG KO K12309 > 

RIKEN DNA Bank Human Resource - GLB1

Gene ID NCBI Gene 2720 |  KEGG hsa:2720
Gene Symbol GLB1
Protein Name galactosidase beta 1
Synonyms EBP|ELNR1|MPS4B
Featured content Lysosome (human)
Ortholog resource in our bank

  GLB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081563 IRAL003P03 pOTB7 BC007493 NM_000404 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR163305 ARi08E09 pGCAP10 NM_000404.2  
GGGGCGCCGACTGCAGAGCCGGGAGGCTGGTGGTCATGCCGGGGTTCCTGGTTCGCATCC
HKR173210 ARi33A10 pGCAP10 NM_000404.2  
GGCGGTGCCAGGCCGTGGGTCCTTAGTCAAGTGACGCGAAGCGGCCGGCCTGGGCGCCGA
HKR182169 ARi55H01 pGCAP10 NM_000404.2  
GGGGCGCCGACTGCAGAGCCGGGAGGCTGGTGGTCATGCCGGGGTTCCTGGTTCGCATCC
HKR238775 ARiS096P15 pGCAP10 NM_000404.2  
GAGTCAAGTGACGCGAAGCGGCCGGCCTGGGCGCCGACTGCAGAGCCGGGAGGCTGGTGG
HKR348834 RBb72B10 pGCAP1 NM_000404.2  
GGCCGACTGCAGAGCCGGGAGGCTGGTGGTCATGCCGGGGTTCCTGGTTCGCATCCTCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl