RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - GGT7

Gene ID	NCBI Gene 2686 \| KEGG hsa:2686
Gene Symbol	GGT7
Protein Name	gamma-glutamyltransferase 7
Synonyms	D20S101\|GGT4\|GGTL3\|GGTL5

Ortholog resource in our bank

  GGT7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR182900	ARi57E04	pGCAP10	NM_178026.2	VA
HKR182900	GAGGCGCTGCGCTGCTGGGGGGCGCGGGCGAGGATGGCGGCGGAGAACGAGGCCAGCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl