Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GGT7

Gene ID (NCBI) 2686
Gene Symbol GGT7
Protein Name gamma-glutamyltransferase 7
Synonyms D20S101|GGT4|GGTL3|GGTL5
Databases KEGG hsa:2686 |  NCBI Gene 2686
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00681)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR182900 ARi57E04 pGCAP10 NM_178026.2  
GAGGCGCTGCGCTGCTGGGGGGCGCGGGCGAGGATGGCGGCGGAGAACGAGGCCAGCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl