Prev. |  KEGG KO K07846 > 

RIKEN DNA Bank Human Resource - GEM

Gene ID NCBI Gene 2669 |  KEGG hsa:2669
Gene Symbol GEM
Protein Name GTP binding protein overexpressed in skeletal muscle
Synonyms KIR
Ortholog resources KEGG ortholog (KEGG orthology K07846) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY013390 IRAK033H22 pBluescriptR BC022010 NM_181702 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162953 ARi07G09 pGCAP10 NM_005261.2  
GAGGCGGCGGGCAAGGACGGCGGGCACAGCGCAGCACTCCCCGCTCGTTGGCCCGGGTAT
HKR205566 ARiS013P06 pGCAP10 NM_005261.2  
GGGCGGNCAAGGACGGCGGGCACAGCGCAGCACTCCCCGCTCGTTGGCCCGGGTATCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl