Prev. |  KEGG KO K17255 > 

RIKEN DNA Bank Human Resource - GDI1

Gene ID NCBI Gene 2664 |  KEGG hsa:2664
Gene Symbol GDI1
Protein Name GDP dissociation inhibitor 1
Synonyms 1A|GDIL|MRX41|MRX48|OPHN2|RABGD1A|RABGDIA|XAP-4
Ortholog resource in our bank

  GDI1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX004904 IRAK012E08 pCMV-SPORT6 BC012201 NM_001493 Full
HGY080545 IRAL001G01 pOTB7 BC000317 NM_001493 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405390 RBdS013H22 pGCAP10 NM_001493.2  
TGGATCTTTGGTCCAGTGCGGTGGCGGCGGCGGCGGTGGCGGCGGCGACTGCTGCGGTGA
HKR409141 RBdS022O05 pGCAP10 NM_001493.2  
GGGTCCAGTGCGGTGGCGGCGGCGGCGGTGGCGGCGGCGACTGCTGCGGTGAAGGAGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl