Prev. |  KEGG KO K02437 > 

RIKEN DNA Bank Human Resource - GCSH

Gene ID NCBI Gene 2653 |  KEGG hsa:2653
Gene Symbol GCSH
Protein Name glycine cleavage system protein H
Synonyms GCE|NKH
Ortholog resource in our bank

  GCSH

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001603 IRAK004A03 pCMV-SPORT6 BC000790 NM_004483 Full/var
HGX005485 IRAK013L21 pCMV-SPORT6 BC009065 NM_004483 Full/var
HGY094057 IRAL035C09 pDNR-LIB BC020922 NM_004483 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE091614 M01C029A14 pDONR221 MGC04-B07 BC000790 NM_004483  
HGE091662 M01C029C14 pDONR221 MGC04-B07 BC000790 NM_004483  
HGE091710 M01C029E14 pDONR221 MGC04-B07 BC000790 NM_004483  
HGE091758 M01C029G14 pDONR221 MGC04-B07 BC000790 NM_004483  
HGE091806 M01C029I14 pDONR221 MGC04-B07 BC000790 NM_004483  
HGE091854 M01C029K14 pDONR221 MGC04-B07 BC000790 NM_004483  
HGE091902 M01C029M14 pDONR221 MGC04-B07 BC000790 NM_004483  
HGE091950 M01C029O14 pDONR221 MGC04-B07 BC000790 NM_004483  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072897 ARe82E01 pKA1U5 NM_004483.3  
GACCCCTGCGAACATGGCGCTGCGAGTGGTGCGGAGCGTGCGGGCCCTGCTCTGCACCCT
HKR335660 RBb39C12 pGCAP1 NM_004483.3  
GACCCCTGCGAACATGGCGCTGCGAGTGGTGCGGAGCGTGCGGGCCCTGCTCTGCACCCT
HKR348075 RBb70D03 pGCAP1 NM_004483.3  
GGCGGGTGGCCGAAGGCGTAGCGCTGCGACCCCCGCACCCCTGCGAACATGGCGCTGCGA
HKR461928 RBdS154N16 pGCAP10 NM_004483.3  
GGCACCCCTGCGAACATGGCGCTGCGAGTGGTGCGGAGCGTGCGGGCCCTGCTCTGCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl