Prev. |  KEGG KO K20899 > 

RIKEN DNA Bank Human Resource - GBP3

Gene ID NCBI Gene 2635 |  KEGG hsa:2635
Gene Symbol GBP3
Protein Name guanylate binding protein 3
Synonyms -
Ortholog resource in our bank

  GBP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056496 IRAK141D24 pCMV-SPORT6 BC063819 NM_018284 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045631 ARe14B07 pKA1U5 NM_018284.2  
GAGGCTCTGAAGCCATTACAAAGGTTGCTTAACTTCTAATTATTTGATCACTGAGGAAAA
HKR247315 ARiS118E19 pGCAP10 NM_018284.2  
GAGAAGTACTTTCNGTTTCNTTNNGCTCTGAAGCCATTACAAAGGTTGCTTAACTTCTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl