Prev. |  KEGG KO K01201 > 

RIKEN DNA Bank Human Resource - GBA

Gene ID NCBI Gene 2629 |  KEGG hsa:2629
Gene Symbol GBA
Protein Name glucosylceramidase beta
Synonyms GBA1|GCB|GLUC
Featured content Lysosome (human)
Ortholog resource in our bank

  GBA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001349 IRAK003G05 pCMV-SPORT6 BC003356 NM_001005750 Full
HGY080693 IRAL001M05 pOTB7 BC000349 NM_001005750 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099605 M01C049A05 pDONR221 MGC14-A03 BC000349 ENST00000368374  
HGE099653 M01C049C05 pDONR221 MGC14-A03 BC000349 ENST00000368374  
HGE099701 M01C049E05 pDONR221 MGC14-A03 BC000349 ENST00000368374  
HGE099749 M01C049G05 pDONR221 MGC14-A03 BC000349 ENST00000368374  
HGE099797 M01C049I05 pDONR221 MGC14-A03 BC000349 ENST00000368374  
HGE099845 M01C049K05 pDONR221 MGC14-A03 BC000349 ENST00000368374  
HGE099893 M01C049M05 pDONR221 MGC14-A03 BC000349 ENST00000368374  
HGE099941 M01C049O05 pDONR221 MGC14-A03 BC000349 ENST00000368374  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014619 W01A036J03 pENTR-TOPO IRAL001M05 BC000349 NM_001005750  
HGE015658 W01A039C10 pENTR-TOPO IRAK003G05 BC003356 NM_001005750  
HGE015660 W01A039C12 pENTR-TOPO IRAK003G05 BC003356 NM_001005750  
HGE015664 W01A039C16 pENTR-TOPO IRAK003G05 BC003356 NM_001005750  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047232 ARe18B08 pKA1U5 NM_000157.1  
GGGGAAGCCGGAATTACTTGCAGGGCTAACCTAGCTGCCTATAGCTAAGGCAGGTACCTG
HKR162407 ARi06A07 pGCAP10 NM_000157.1  
GACTTGCAGGGCTAACCTAGTGCCTATAGCTAAGGCAGGTACCTGCATCCTTGTTTTTGT
HKR234141 ARiS085F21 pGCAP10 NM_000157.1  
GAGGGCTGCTTTTCTCGCGGCTGCGGGTGGTCGGGCTGCATCCTGCCTTCAGAGTCTTAC
HKR373356 RBd33G12 pGCAP10 NM_000157.1  
GAGGGCTAACCTAGTGCCTATAGCTAAGGCAGGTACCTGCATCCTTGTTTTTGTTTAGTG
HKR373369 RBd33H01 pGCAP10 NM_000157.1  
GGCCATTTTGGAGGGGCCGCGGGAGACGTGGTGCCGCTGCGGGCTCGCTCTGCCGTGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl