Prev. |  KEGG KO K05464 > 

RIKEN DNA Bank Human Resource - GAS6

Gene ID NCBI Gene 2621 |  KEGG hsa:2621
Gene Symbol GAS6
Protein Name growth arrest specific 6
Synonyms AXLLG|AXSF
Ortholog resources KEGG ortholog (KEGG orthology K05464) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033062 IRAK082K22 pCMV-SPORT6 BC038984 NM_000820 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE008034 W01A020B10 pENTR-TOPO IRAK082K22 BC038984 NM_000820  
HGE008036 W01A020B12 pENTR-TOPO IRAK082K22 BC038984 NM_000820  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052150 ARe30G06 pKA1U5 NM_000820.2  
GGCCGCGATGTGACCTTCAGGGCCGCCAGGACGGGATGACCGGAGCCTCCGCCCCGCGGC
HKR052947 ARe32G03 pKA1U5 NM_000820.2  
GCCAGACCGAGCGCTTGAGGTGCCGCAGCCGCCNCNTTNNNCCGCCGCCGCGATGTGACC
HKR063303 ARe58E07 pKA1U5 NM_000820.2  
GGCCGCGATGTGACCTTCAGGGCCGCCAGGACGGGATGACCGGAGCCTCCGCCCCGCGGC
HKR069259 ARe73C11 pKA1U5 NM_000820.2  
GAGACCGAGCGCTTGAGGTGCCGCATCCGCCGCCGNTGANCGCCGCCGCGATGTGACCTT
HKR167212 ARi18A12 pGCAP10 NM_000820.2  
GGCCGCCGCGATGTGACCTTCAGGGCCGCCAGGACGGGATGACCGGAGCCTCCGCCCCGC
HKR168154 ARi20G10 pGCAP10 NM_000820.2  
GAGACCGAGCGCTTGAGGTGCCGCAGCCGCCGCCGCCGCCGCCGCCGCGATGTGACCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl