Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GART

Gene ID (NCBI) 2618
Gene Symbol GART
Protein Name phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase
Synonyms AIRS|GARS|GARTF|PAIS|PGFT|PRGS
Databases KEGG hsa:2618 |  NCBI Gene 2618
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11787)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052483 ARe31D11 pKA1U5 NM_000819.4  
GGGCGAGCGGGCAAGCGGGAACCAGGTGGCCACCCGGTGTCGGTTTCATTTTCCTTTGGA
HKR382531 RBd56F11 pGCAP10 NM_000819.4  
GGGGCCGACTTCCGGCGAGCGGGCAAGCGGGAACCAGGTGGCCACCCGGTGTCGGTTTCA
HKR398828 RBd97B04 pGCAP10 NM_000819.4  
GGGGCCGACTTCCGGCGAGCGGGCAAGCGGGAACCAGGTGGCCACCCGGTGTCGGTTTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl