Prev. |  KEGG KO K01880 > 

RIKEN DNA Bank Human Resource - GARS

Gene ID NCBI Gene 2617 |  KEGG hsa:2617
Gene Symbol GARS
Protein Name glycyl-tRNA synthetase
Synonyms CMT2D|DSMAV|GlyRS|HMN5|SMAD1
Ortholog resources KEGG ortholog (KEGG orthology K01880) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083158 IRAL007O22 pOTB7 BC000065 NM_002047 Full/var
HGY086894 IRAL017D22 pOTB7 BC007755 NM_002047 Full
HGY087106 IRAL017M18 pOTB7 BC007722 NM_002047 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163652 ARi09C04 pGCAP10 NM_002047.2  
GGGCGATTTCATCATGCTCCGAGCCGGGCGGCGCGCGCCGCTTCCGTCGCCACCCTCTCT
HKR178551 ARi46G07 pGCAP10 NM_002047.2  
GGCTTCCGTCGCCACCCTCTCTGGACAGCCCAGGGCCGCAGGCTCATGCCCTCTCCGCGT
HKR235447 ARiS088K07 pGCAP10 NM_002047.2  
GACAGCCCAGGGCCGCAGGCTCATGCCCTCTCCGCGTCCAGTGCTGCTTAGAGGTGCTCG
HKR364001 RBd10A01 pGCAP10 NM_002047.2  
GTCAATTTCCNCATGCTCCGAGCCCGGCGGGGCGCNCCGCTTCCGNCGCACCCTCTCTGG
HKR379730 RBd49F10 pGCAP10 NM_002047.2  
GGGGCGGCGCGCGCCGCTTCCGTCGCCACCCTCTCTGGACAGCCCAGGGCCGCAGGCTCA
HKR416353 RBdS040O17 pGCAP10 NM_002047.2  
GGTCGTTTACGCGGCGATTTCATCATGCTCCGAGCCGGGCGGCGCGCGCCGCTTCCGTCG
HKR420571 RBdS051H03 pGCAP10 NM_002047.2  
GGTCGCCACCCTCTCTGGACAGCCCAGGGCCGCAGGCTCATGCCCTCTCCGCGTCCAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl