Prev. |  KEGG KO K00134 > 

RIKEN DNA Bank Human Resource - GAPDH

Gene ID NCBI Gene 2597 |  KEGG hsa:2597
Gene Symbol GAPDH
Protein Name glyceraldehyde-3-phosphate dehydrogenase
Synonyms G3PD|GAPD|HEL-S-162eP
Ortholog resources KEGG ortholog (KEGG orthology K00134) in the DNA Bank
Featured content HIF-1 signaling pathway - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15088 pcDNA5-GAPDH-HaloTag Expression vector for the visualization of chaperone-mediated autophagy (CMA).

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005415 IRAK013I23 pCMV-SPORT6 BC009081 NM_002046 Full
HGX005610 IRAK014A10 pCMV-SPORT6 BC029618 NM_002046 Full
HGX011632 IRAK029B08 pCMV-SPORT6 BC026907 NM_002046 Full
HGY083410 IRAL008I18 pOTB7 BC001601 NM_002046 Full
HGY084656 IRAL011K16 pOTB7 BC013310 NM_002046 Full
HGY085799 IRAL014I07 pOTB7 BC004109 NM_002046 Full
HGY088900 IRAL022E04 pOTB7 BC025925 NM_002046 Full
HGY093520 IRAL033N08 pOTB7 BC023632 NM_002046 Full
HGY103217 IRAL058A17 pOTB7 BC083511 NM_002046 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040428 ARe01B04 pKA1U5 NM_002046.3  
GGCTCCTCCTGCTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATC
HKR040572 ARe01H04 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCCACAGTCANCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR040827 ARe02B03 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR040950 ARe02G06 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR041250 ARe03C02 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR041325 ARe03F05 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR041702 ARe04E06 pKA1U5 NM_002046.3  
GGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTTCTTTTGCGTCGCCAGCCGA
HKR041721 ARe04F01 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR042801 ARe07A01 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCATTCTTTTGCGTCGCCAGCCGAG
HKR042860 ARe07C12 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR042975 ARe07H07 pKA1U5 NM_002046.3  
TGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR043207 ARe08A07 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGATTCGACAGATCAGCCGCATCNTTCTTTTGCGTCGCCAGCCG
HKR043603 ARe09A03 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR043723 ARe09F03 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTTCTTTTGCGTCGCCAGCCGAG
HKR043725 ARe09F05 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR043771 ARe09H03 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR043777 ARe09H09 pKA1U5 NM_002046.3  
ATCCTGGTGGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGC
HKR044029 ARe10B05 pKA1U5 NM_002046.3  
GGCTCTGCTCCTCCTGATTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR044555 ARe11G11 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR046925 ARe17F05 pKA1U5 NM_002046.3  
GCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACAT
HKR047234 ARe18B10 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR047308 ARe18E12 pKA1U5 NM_002046.3  
TGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR047774 ARe19H06 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCATTCTTTTGCGTCGCCAGCCGAG
HKR048908 ARe22E12 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR049253 ARe23C05 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR049328 ARe23F08 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR049628 ARe24B04 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR050055 ARe25C07 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR051277 ARe28D05 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR051356 ARe28G12 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR052545 ARe31G01 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR052849 ARe32C01 pKA1U5 NM_002046.3  
TGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR053212 ARe33A12 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCATTCTTTTGCGTCGCCAGCCGAG
HKR053322 ARe33F02 pKA1U5 NM_002046.3  
GGCGTCTCNGCTCCTCCTGGTTCGACAGNNANCCGCATCNTTCTTTTGCGTCANCAGCCG
HKR053731 ARe34F11 pKA1U5 NM_002046.3  
TGGCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR053780 ARe34H12 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR054083 ARe35D11 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCATTCTTTTGCGTCGCCAGCCGAG
HKR054453 ARe36C05 pKA1U5 NM_002046.3  
GTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR054458 ARe36C10 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTTCAGCCNCATCTTCTTTTGCGTCGCCAGCCGAG
HKR054529 ARe36F09 pKA1U5 NM_002046.3  
GTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR055251 ARe38C03 pKA1U5 NM_002046.3  
AGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCATTCTTTTGCGTCGCCAGCCGA
HKR055601 ARe39A01 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR055753 ARe39G09 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR055773 ARe39H05 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR056545 ARe41G01 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR057322 ARe43F02 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR057328 ARe43F08 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATTTTCTTTTGCGTCGCCAGCCGAGC
HKR057754 ARe44G10 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR058121 ARe45F01 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR058454 ARe46C06 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR058523 ARe46F03 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCATTCTTTTGCGTCGCCAGCCGAG
HKR058849 ARe47C01 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR058900 ARe47E04 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGATCAGCCGCATCATTCTTTTGCGTCGCCAGCCGA
HKR059305 ARe48E09 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGCTCAGCCGCATCGTTCTTTTGCGTCGCCAGCCGA
HKR060156 ARe50G12 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR060408 ARe51A08 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR060480 ARe51D08 pKA1U5 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR060555 ARe51G11 pKA1U5 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTTCTTTTGCGTCGCCAGCCGAGC
HKR060971 ARe52H03 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGGTTCGACAGATCAGCCCCNTTTNCTTTTGCGTCGCCAGCCGA
HKR061348 ARe53G04 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGNTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR061755 ARe54G11 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR062008 ARe55A08 pKA1U5 NM_002046.3  
GGCTCCTCCTGCTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATC
HKR062084 ARe55D12 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTNAGCCNCATNTTCTTTTGCGTCGCCAGCCGAGC
HKR062879 ARe57D07 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR062907 ARe57E11 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR063325 ARe58F05 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR063354 ARe58G10 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR063659 ARe59C11 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR063749 ARe59G05 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR064804 ARe62A04 pKA1U5 NM_002046.3  
TTGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGA
HKR064908 ARe62E12 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR066003 ARe65A03 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGNTCAGCCGCATTTTCTTTTGCGTCGCCAGCCGAG
HKR066155 ARe65G11 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR066476 ARe66D04 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR066523 ARe66F03 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGATTCGACAGATCAGCCGCATCTTCTTTTGCGTCGCCAGCCGA
HKR066955 ARe67G11 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR067211 ARe68A11 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTTCTTTTGCGTCGCCAGCCGAG
HKR067226 ARe68B02 pKA1U5 NM_002046.3  
ATCCTGTGCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCC
HKR067745 ARe69G01 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR068153 ARe70G09 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR068426 ARe71B02 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR068434 ARe71B10 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR068530 ARe71F10 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCACCTTTTTTTTGCGTCGCCAGCCGAGCCA
HKR068550 ARe71G06 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCANCNTTTNTTTTGCGTCGCCAGCCGAGCC
HKR068931 ARe72F11 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR069274 ARe73D02 pKA1U5 NM_002046.3  
TTGGCTCTCTGCTCCTCCTGTTTCGACAGATCAGCCGCATCATTCTTTTGCGTCGCCNGC
HKR069370 ARe73H02 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGNTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR069601 ARe74A01 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCCCNTTNNTCATTTTGCGTCGCCAGCCGA
HKR069724 ARe74F04 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCNCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR070101 ARe75E05 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR070428 ARe76B04 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGATCAGCCCCCNTTNNCTTTTGCGTCGCCAGCCGA
HKR070480 ARe76D08 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCNCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR070803 ARe77A03 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGATCAGCCGCATNTTCTTTTGCGTCGCCAGCCGAG
HKR070834 ARe77B10 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCNCATNTTCTTTTGCGTCGCCAGCCGAGC
HKR070925 ARe77F05 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGNTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR070926 ARe77F06 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCNCATNTTCTTTTGCGTCGCCAGCCGAGC
HKR070927 ARe77F07 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATNTTCTTTTGCGTCGCCAGCCGAGC
HKR071375 ARe78H07 pKA1U5 NM_002046.3  
ATCCTGTGGCTCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGC
HKR073233 ARe83B09 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR073751 ARe84G07 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR074074 ARe85D02 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR074179 ARe85H11 pKA1U5 NM_002046.3  
GCTTCCTTTCTGGGCTCGGACCTAGGTCGCGGCGACATGGCCAAACGTACCAAGAAAGTC
HKR074528 ARe86F08 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR074849 ARe87C01 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR074976 ARe87H08 pKA1U5 NM_002046.3  
GCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACAT
HKR075227 ARe88B03 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR075625 ARe89B01 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR075649 ARe89C01 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR076027 ARe90B03 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTTGCGTCGCCAGCCGAGCCA
HKR076107 ARe90E11 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR076549 ARe91G05 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR076850 ARe92C02 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR076908 ARe92E12 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR077631 ARe94B07 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR077746 ARe94G02 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR078102 ARe95E06 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR079225 ARe98B01 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR079234 ARe98B10 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR079605 ARe99A05 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGCTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR080576 ARf01H08 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR081236 ARf03B12 pKA1U5 NM_002046.3  
GGCCTCTCTGCTCCTCCTGATTCGACAGTCAGNCGCATCTTTCGTTTTGCGTCGCCAGCC
HKR081776 ARf04H08 pKA1U5 NM_002046.3  
TGGCTCTCTGCTCCTCCNGCTTCGACAGTCANCCCCNTCTTCGTTTTGCGCTCGCCAGCC
HKR082172 ARf05H04 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTTCTTTTGCGTCGCCAGCCGAG
HKR082555 ARf06G11 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR160477 ARi01D05 pGCAP10 NM_002046.3  
TGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR160547 ARi01G03 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR160857 ARi02C09 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR161229 ARi03B05 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR161231 ARi03B07 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR161273 ARi03D01 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR161659 ARi04C11 pGCAP10 NM_002046.3  
GCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACAT
HKR162481 ARi06D09 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR162812 ARi07A12 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR162950 ARi07G06 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR163674 ARi09D02 pGCAP10 NM_002046.3  
GGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCG
HKR164098 ARi10E02 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR164102 ARi10E06 pGCAP10 NM_002046.3  
TGGCCGGCCGATTTTTTTTTTGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTT
HKR164853 ARi12C05 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR164953 ARi12G09 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR165274 ARi13D02 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR165747 ARi14G03 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR166556 ARi16G12 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR167625 ARi19B01 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGGCAGCCGCATCTTCTTTTTANNCGCCAGCCGAG
HKR167650 ARi19C02 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR167705 ARi19E09 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR168031 ARi20B07 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR168074 ARi20D02 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR168456 ARi21C08 pGCAP10 NM_002046.3  
GCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACAT
HKR170012 ARi25A12 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR170477 ARi26D05 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR171278 ARi28D06 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR171649 ARi29C01 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR171676 ARi29D04 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR171731 ARi29F11 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTNTGCGTCGCCAGCCGAGC
HKR172532 ARi31F12 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR172578 ARi31H10 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR174005 ARi35A05 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR174148 ARi35G04 pGCAP10 NM_002046.3  
GCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACAT
HKR174408 ARi36A08 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR174834 ARi37B10 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR175228 ARi38B04 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR177774 ARi44H06 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR179302 ARi48E06 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR179631 ARi49B07 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR180080 ARi50D08 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR181626 ARi54B02 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR182428 ARi56B04 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR182571 ARi56H03 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR183652 ARi59C04 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR184026 ARi60B02 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR184050 ARi60C02 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR184499 ARi61E03 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR184505 ARi61E09 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR184802 ARi62A02 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR184860 ARi62C12 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR184927 ARi62F07 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR185699 ARi64E03 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCGCATCTCNTTNNGTCGCAGCGAGCACATCGCTG
HKR186077 ARi65D05 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR186078 ARi65D06 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR186124 ARi65F04 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR186147 ARi65G03 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR186529 ARi66F09 pGCAP10 NM_002046.3  
GGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCG
HKR186978 ARi67H10 pGCAP10 NM_002046.3  
GGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCG
HKR187328 ARi68F08 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR187330 ARi68F10 pGCAP10 NM_002046.3  
GGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCG
HKR187698 ARi69E02 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR203239 ARiS008B15 pGCAP10 NM_002046.3  
GGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCG
HKR203376 ARiS008H08 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR203551 ARiS008O15 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGNNCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR205220 ARiS013A20 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR208046 ARiS020B22 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR208229 ARiS020J13 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR208230 ARiS020J14 pGCAP10 NM_002046.3  
GGCTCNNTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR208255 ARiS020K15 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR208287 ARiS020L23 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR208353 ARiS020O17 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR209308 ARiS023E12 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR209326 ARiS023F06 pGCAP10 NM_002046.3  
GTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR209454 ARiS023K14 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR218073 ARiS045D01 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR218086 ARiS045D14 pGCAP10 NM_002046.3  
TAAGGGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGC
HKR218163 ARiS045G19 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR219608 ARiS049A08 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR219734 ARiS049F14 pGCAP10 NM_002046.3  
TGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR222075 ARiS055D03 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR222318 ARiS055N06 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR234035 ARiS085B11 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR234131 ARiS085F11 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR234230 ARiS085J14 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR234829 ARiS087B05 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR234875 ARiS087D03 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCNACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR234877 ARiS087D05 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR235003 ARiS087I11 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR235237 ARiS088B13 pGCAP10 NM_002046.3  
TGGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGA
HKR235241 ARiS088B17 pGCAP10 NM_002046.3  
TGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR235372 ARiS088H04 pGCAP10 NM_002046.3  
GCTCTCCCTCCGCGCAGCCGAGCCACATCGCTCAGACACCATGGGGAAGGTGAAGGTCGG
HKR235468 ARiS088L04 pGCAP10 NM_002046.3  
TGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR235576 ARiS088P16 pGCAP10 NM_002046.3  
GTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR238522 ARiS096F02 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR238623 ARiS096J07 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTTNNNNTCANCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCNCA
HKR243621 ARiS109A21 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR243795 ARiS109I03 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR243796 ARiS109I04 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR243926 ARiS109N14 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR247226 ARiS118B02 pGCAP10 NM_002046.3  
GGCTCCTCCTGTTCGACAGTCANCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCG
HKR247337 ARiS118F17 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR247479 ARiS118L15 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR247524 ARiS118N12 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR247568 ARiS118P08 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR248813 ARiS122A13 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR248876 ARiS122D04 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR248931 ARiS122F11 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR249067 ARiS122L03 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR249121 ARiS122N09 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR260133 ARiS150F13 pGCAP10 NM_002046.3  
AATTGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCC
HKR260186 ARiS150H18 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR260199 ARiS150I07 pGCAP10 NM_002046.3  
GGCTCTCTGCTNNTCCNGNTCGACATTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR260371 ARiS150P11 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR264446 ARiS161B22 pGCAP10 NM_002046.3  
GNNTCTCTGCTCCTCCTGNNCNACAGTCACCCGCNTCTTCTTTTGCNTCTCCAGCCNANC
HKR264627 ARiS161J11 pGCAP10 NM_002046.3  
GTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR264746 ARiS161O10 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR276472 ARiS191C24 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR276497 ARiS191E01 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR276771 ARiS191P11 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR277629 ARiS194B05 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR277837 ARiS194J21 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR277896 ARiS194M08 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR279208 ARiS198A08 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR279254 ARiS198C06 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR279301 ARiS198E05 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR279308 ARiS198E12 pGCAP10 NM_002046.3  
GGCTCTCNGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR279421 ARiS198J05 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR320501 RBb01E05 pKA1U5 NM_002046.3  
ATCCTGAGGCTCTCTGCTCCTCCTGTTCGACAGCTCAGCCGCATCTTCTTTTGCGTCGCC
HKR320570 RBb01H02 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR321654 RBb04C06 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR322946 RBb07G02 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR323299 RBb08E03 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR323629 RBb09B05 pKA1U5 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR323681 RBb09D09 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR324174 RBb10H06 pKA1U5 NM_002046.3  
GTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR327281 RBb18D09 pKA1U5 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR329260 RBb23C12 pGCAP1 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR330036 RBb25B12 pGCAP1 NM_002046.3  
GCTCTGCTCCTCCTGNTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR330545 RBb26G01 pGCAP1 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR331254 RBb28C06 pGCAP1 NM_002046.3  
GTGTCTCTGCTCCTCCTGNTTCGANAGATCAGCCGCATCTTCCTTTTGCGATCGNCAGCC
HKR331276 RBb28D04 pGCAP1 NM_002046.3  
GGCTCTCTGCTCCTCCTGNTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR331279 RBb28D07 pGCAP1 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR331331 RBb28F11 pGCAP1 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR331631 RBb29B07 pGCAP1 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR331682 RBb29D10 pGCAP1 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR332152 RBb30G08 pGCAP1 NM_002046.3  
GGCTCTCTGCTCCTCCTGNTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR332830 RBb32B06 pGCAP1 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR334155 RBb35G11 pGCAP1 NM_002046.3  
TGCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR335352 RBb38G08 pGCAP1 NM_002046.3  
TGTCTCTGCTCCTCCTGCTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR335722 RBb39F02 pGCAP1 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTTCAGTCCGCATTCTTTCTTTTGCGTCGCCAGC
HKR335776 RBb39H08 pGCAP1 NM_002046.3  
TGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR336005 RBb40A05 pGCAP1 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR336129 RBb40F09 pGCAP1 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTTCTTTTGCGTCGCCAGCCGAGCCA
HKR337259 RBb43C11 pGCAP1 NM_002046.3  
TTTGGCTCTCTGCTCCTCCTGNTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCC
HKR339379 RBb48H11 pGCAP1 NM_002046.3  
GGCTCTCTGCTCCTCCTGNTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR340009 RBb50A09 pGCAP1 NM_002046.3  
ATGAAGTCGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGACATCTTTCTTTTGCGT
HKR340051 RBb50C03 pGCAP1 NM_002046.3  
AAATGTGGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAG
HKR340925 RBb52F05 pGCAP1 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGATCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR341725 RBb54F05 pGCAP1 NM_002046.3  
GGCTCTCTGCTCCTCCTGNTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR341754 RBb54G10 pGCAP1 NM_002046.3  
GGCTCTGCTCCTCCTGNTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR344580 RBb61H12 pGCAP1 NM_002046.3  
TTTGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCG
HKR345231 RBb63B07 pGCAP1 NM_002046.3  
TTGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGA
HKR345707 RBb64E11 pGCAP1 NM_002046.3  
GTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR346152 RBb65G08 pGCAP1 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR346852 RBb67C04 pGCAP1 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR348527 RBb71F07 pGCAP1 NM_002046.3  
TGTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR348973 RBb72H05 pGCAP1 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR366150 RBd15G06 pGCAP10 NM_002046.3  
TGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR367606 RBd19A06 pGCAP10 NM_002046.3  
GGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR369349 RBd23G05 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR370500 RBd26E04 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR373308 RBd33E12 pGCAP10 NM_002046.3  
GTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR373698 RBd34E02 pGCAP10 NM_002046.3  
GTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR373702 RBd34E06 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR376007 RBd40A07 pGCAP10 NM_002046.3  
GTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR376127 RBd40F07 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR380001 RBd50A01 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR380099 RBd50E03 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR380825 RBd52B01 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR381234 RBd53B10 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR381375 RBd53H07 pGCAP10 NM_002046.3  
GTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTNNNNNCGCCAGCCGAGCCA
HKR381632 RBd54B08 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTNNNTCGCCAGCCGAGC
HKR382004 RBd55A04 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTNNNTCGCCAGCCGAGC
HKR382835 RBd57B11 pGCAP10 NM_002046.3  
TGCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR384459 RBd61C11 pGCAP10 NM_002046.3  
TCGCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR386404 RBd66A04 pGCAP10 NM_002046.3  
GCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACAT
HKR386435 RBd66B11 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR387211 RBd68A11 pGCAP10 NM_002046.3  
GTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR387303 RBd68E07 pGCAP10 NM_002046.3  
GTTACTTCTGCTCTGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGC
HKR388081 RBd70D09 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR388479 RBd71D07 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR390125 RBd75F05 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR391229 RBd78B05 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR392169 RBd80H01 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR393676 RBd84D04 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR395212 RBd88A12 pGCAP10 NM_002046.3  
TTGGCTGCTCCTGTTCGACAATCAGCCGCATCTTCTTTTGCGTCGCCGGCTGAGCCACAT
HKR395654 RBd89C06 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR397327 RBd93F07 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR398155 RBd95G11 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR398926 RBd97F06 pGCAP10 NM_002046.3  
GGTTCTCTGCTCCTCCTGTTCGACAGTCTGCCGCATCTTCTTTTGCGTCCCCCGCCAAGC
HKR398946 RBd97G02 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR402814 RBdS007A14 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR402939 RBdS007F19 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR403084 RBdS007L20 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR403118 RBdS007N06 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR405224 RBdS013A24 pGCAP10 NM_002046.3  
GGGTTTCTATAAATTGAGCCCGCAGCCTCCCGCTTCGCTCTCTGCTCCTCCTGTTCGACA
HKR406375 RBdS015P15 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR408826 RBdS022B02 pGCAP10 NM_002046.3  
TGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR408858 RBdS022C10 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR408960 RBdS022G16 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR409009 RBdS022I17 pGCAP10 NM_002046.3  
GTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCA
HKR416016 RBdS040A16 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR416116 RBdS040E20 pGCAP10 NM_002046.3  
TGACNGGCCCTCCCTNCNGNTCCACAGNNNGCCGCATCTTCTTTTGCGTCTCCAGCCNAN
HKR416158 RBdS040G14 pGCAP10 NM_002046.3  
TGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR416347 RBdS040O11 pGCAP10 NM_002046.3  
GCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACAT
HKR420457 RBdS051C09 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR420519 RBdS051E23 pGCAP10 NM_002046.3  
CCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCAC
HKR420664 RBdS051K24 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR420726 RBdS051N14 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGANNNTCAGCCGCATCTTCTTTTGCGTCNNCAGCCGNNN
HKR428047 RBdS070B23 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR428116 RBdS070E20 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR430290 RBdS075M02 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR430322 RBdS075N10 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR432433 RBdS081B09 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR432524 RBdS081F04 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR441682 RBdS104D10 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR442085 RBdS105D13 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR442212 RBdS105I20 pGCAP10 NM_002046.3  
GATATAAATTGAGCCCGCAGCCTCCCGCTTCGCTCTCTGCTCCTCCTGTTCGACAGTCAG
HKR442280 RBdS105L16 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR452852 RBdS132C04 pGCAP10 NM_002046.3  
TGGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAG
HKR461622 RBdS154A22 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR461629 RBdS154B05 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR461752 RBdS154G08 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR461792 RBdS154H24 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR461811 RBdS154I19 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR462414 RBdS156A14 pGCAP10 NM_002046.3  
GGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCCACATCG
HKR462486 RBdS156D14 pGCAP10 NM_002046.3  
AAAATTGAGCCCGCAGCCTCCCGCTTCGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGC
HKR462496 RBdS156D24 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR462614 RBdS156I22 pGCAP10 NM_002046.3  
GGCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGC
HKR474929 RBdS187F09 pGCAP10 NM_002046.3  
GCTCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTTTGCGTCGCCAGCCGAGCC
HKR475014 RBdS187I22 pGCAP10 NM_002046.3  
GCTCTGCTCCTCCTGTTCGACAGTCAGCCGCATCTTCTTNGCGTCGCCAGCCGAGCCACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl