Prev. |  KEGG KO K00542 > 

RIKEN DNA Bank Human Resource - GAMT

Gene ID NCBI Gene 2593 |  KEGG hsa:2593
Gene Symbol GAMT
Protein Name guanidinoacetate N-methyltransferase
Synonyms CCDS2|HEL-S-20|PIG2|TP53I2
Ortholog resources KEGG ortholog (KEGG orthology K00542) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081452 IRAL003K12 pOTB7 BC016760 NM_000156 Full
HGY094050 IRAL035C02 pDNR-LIB BC017936 NM_000156 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100005 M01C050A05 pDONR221 MGC14-E03 BC016760 NM_000156  
HGE100053 M01C050C05 pDONR221 MGC14-E03 BC016760 NM_000156  
HGE100101 M01C050E05 pDONR221 MGC14-E03 BC016760 NM_000156  
HGE100149 M01C050G05 pDONR221 MGC14-E03 BC016760 NM_000156  
HGE100197 M01C050I05 pDONR221 MGC14-E03 BC016760 NM_000156  
HGE100245 M01C050K05 pDONR221 MGC14-E03 BC016760 NM_000156  
HGE100293 M01C050M05 pDONR221 MGC14-E03 BC016760 NM_000156  
HGE100341 M01C050O05 pDONR221 MGC14-E03 BC016760 NM_000156  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR332979 RBb32H11 pGCAP1 NM_000156.4  
GGCAGGGAGCGGGCCCGGGCGGCGCGCGATCGAGGTCGGGTCGCCGTCCAGCCTGCAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl