Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GALNT2

Gene ID (NCBI) 2590
Gene Symbol GALNT2
Protein Name UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 (GalNAc-T2)
Synonyms GalNAc-T2
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX032959 IRAK082G15 pCMV-SPORT6 BC041120 NM_004481 Full
HGX043089 IRAK107M01 pCMV-SPORT6 BC050583 NM_004481 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE094426 M01C036B02 pDONR221 MGC07-H01 BC041120 NM_004481 done
HGE094474 M01C036D02 pDONR221 MGC07-H01 BC041120 NM_004481  
HGE094522 M01C036F02 pDONR221 MGC07-H01 BC041120 NM_004481  
HGE094570 M01C036H02 pDONR221 MGC07-H01 BC041120 NM_004481  
HGE094618 M01C036J02 pDONR221 MGC07-H01 BC041120 NM_004481  
HGE094666 M01C036L02 pDONR221 MGC07-H01 BC041120 NM_004481  
HGE094714 M01C036N02 pDONR221 MGC07-H01 BC041120 NM_004481  
HGE094762 M01C036P02 pDONR221 MGC07-H01 BC041120 NM_004481  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163255 ARi08C07 pGCAP10 NM_004481.3  
GACTCGCGAGCAGCGGCGGCCCCGCCGGCGGCCGAGTTGGGAGAATGCGGCGGCGCTCGC
HKR044554 ARe11G10 pKA1U5 NM_004481.3  
GACTCGCGAGCAGCGGCGGCCCCGCCGGCGGCCGAGTTGGGAGAATGCGGCGGCGCTCGC
HKR078900 ARe97E04 pKA1U5 NM_004481.3  
GGCGGCCGGCCCAGGCAGCACTCGCGAGCAGCGGCGGCCCCGCCGGCGGCCGAGTTGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.13

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl