Prev. |  KEGG KO K00710 > 

RIKEN DNA Bank Human Resource - GALNT1

Gene ID NCBI Gene 2589 |  KEGG hsa:2589
Gene Symbol GALNT1
Protein Name polypeptide N-acetylgalactosaminyltransferase 1
Synonyms GALNAC-T1
Ortholog resource in our bank

  GALNT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR184482 ARi61D10 pGCAP10 NM_020474.4 Full/var done
GGCGCTCGCGGCCGCCTCAGGCAGCCGACCGGGTTGGGGCGGCCCCGCGCTCGGCCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl