Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GALNT1

Gene ID (NCBI) 2589
Gene Symbol GALNT1
Protein Name polypeptide N-acetylgalactosaminyltransferase 1
Synonyms GALNAC-T1
Databases KEGG hsa:2589 |  NCBI Gene 2589
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00710)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR184482 ARi61D10 pGCAP10 NM_020474.3 done
GGCGCTCGCGGCCGCCTCAGGCAGCCGACCGGGTTGGGGCGGCCCCGCGCTCGGCCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.01.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180829.pl